FAQ

In principle, DDBJ only accepts updating requests from the original submitter of the entry except reference update. Therefore, if you are not the submitter you will need authorization from the submitter before making requests for the entry.
DDBJ can forward your comments and suggestions to the submitter.
Please contact us via Inquiry to the sequence submitters (submitted to DDBJ).

We only accept this kind of request from the original submitter of the entry.
Please contact us from contact form by selecting the item, "Updating Submitted Data" with accession numbers.

Since DDBJ Nucleotide Sequence Submission System can be only used for new submissions, you can not update submitted data with the system.
For update, see Data Updates/Corrections.

Please contact us from contact form by selecting the item, "Updating Submitted Data" with following items;

• E-mail address of contact person
• Accession numbers or EntryIDs

We will reply with contents of your data.

Contact us from this form with "Our paper was published" in [Subject].

Contact us from this form with "Our paper was accepted" in [Subject].

Contact us from this form by selecting "Change the hold-date" in [Subject].

Contact us from this form with "Change the contact person, belonging, institution, etc.." in [Subject].

Please send your request to with the following contents in clear English.

• Accession numbers:
• The modified part:
• Total base count:
• Other modified feature:
• Updated sequence in full length: Please use the following format.

>AB*****1
aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt
ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc
//
>AB*****2
aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt
ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc
aaaaaaaaaat
//

• Header line; starts with ">", followed by the accession number at the head of each sequence.
• Sequence; each line must be 60 letters or less.
• End line; end flag, "//", must be at the end of each sequence.

If you are making update request for large number of entries, or many changes of features/locations/qualifiers due to sequence modification, see followings.

(1) Update information is in common of all entries.

Example: change reference or submitters information, postpone the hold-date, etc..

In principle, send your request via Application Form for Data Update Requests.

(2) Contents of corrections are different among entries.

Example: change each clone or gene name of all entries, etc..

(3) Extensive correction of data

Example: change more than 30 features due to the sequence update, etc..

In case of (2) or (3), we would like to know the number of entries, the correction item, etc. to specify the file format for your request.
Contact us by mail to to consult in advance.
In general, we handle update requests within several days but for a large number of entries, it might take us time in updating the data.
Be sure to contact us beforehand when you request the release of data which accompanies correction.

Previous versions of sequence data are available by using getentry webAPI.

See gethistory on getentry HELP.

DDBJ does not provide any procedure for a limited disclosure by the password authentication or else.
When you have to show your sequence data submitted with "Hold-Until-Published" status for only particular individuals, you can send as a text file including your sequences to them.
If the referee wish to confirm the condition and/or the descriptions of your sequence submission, you can choose either of the following two procedures;

a) Publish your sequences through DDBJ.

If you do not mind to open your sequences to the public, please send us your request to publicize your submitted sequences with all of accession numbers.

b) Send DDBJ flat files of your submission to the referee, directly

When the submitter requests to us, we send the text file including DDBJ flat files to the submitter. So, please send us your request with all of accession numbers to get DDBJ flat file(s) of your submission. Then, you can forward the text file to the referee.

Contact us by mail to , if necessary.

DDBJ does not accept any reservation for updating sequence data.
Therefore, in case of updating published data, the data will be immediately re-distributed after update.

Please select either of following ways.

• In this time, canceling the request for update, when you can publish updated data, contact us again.
• Submit the updated data as a new data with hold date. When the new data is published, the accession number of the old data will become a secondary accession number for the new data.
  # Please inform us during submitting the new data to link it to the old data.

Reference

• Explanation of DDBJ flat file format: ACCESSION
• INSDC Status Document: Replaced
• What is the secondary accession number?

In principle, DDBJ can not restore any published data.
See also following item about access restriction.

In principle, you cannot remove your sequence data from DDBJ retrieval system: getentry, if it has already been open to the public (If DDBJ wrongly published your data because of any mistakes, the data should be removed as soon as possible.).

However, if there is some specific reason for removing your sequence data (i.e. some error is found, etc.), we can restrict access to your sequence data.

Please send your request to with the following contents.

• Accession numbers:
• Reason in brief:
• New hold-date: (e.g. 2019/06/25)

If we restrict access to your sequence data and remove it from the public view, then it will no longer be included in homology search services at DDBJ or distributed as a part of the next DDBJ periodical release. However, it may remain in other third party databases, and will still be retrievable in getentry by accession number based queries.

Moreover, our unified database may be copied and redistributed without permission at any other organizations. In case you need to withdraw your entry from such database, we ask you to make request directly to the organization which manages the database.

References

Why is the retracted data still available?

INSDC Status Document

In principle, following two conditions are required to delete your sequence data;

1) The sequence data has not yet been publicized
2) The accession number of the data has not yet been published.

Please send your request to with the following contents in clear English.

• Accession numbers:
• Reason in brief:

Just for information, we can restrict access to your sequence data that have been open to the public, if the conditions are right.
See also the following item.

References

How to restore the released data to private?

Why is the retracted data still available?

INSDC Status Document

Generally, DDBJ do not need any offprint to process your data.
Occasionally, DDBJ may contact the submitter of sequence data to ask sending an offprint, if necessary.

If you have specific ID for your data other than accession number, such as EntryID or any, contact us from contact form by selecting the item, "Updating Submitted Data", with ID and E-mail address of contact person.
In case of uncertain, tell us following items as far as you know, then we will search your data.

• Your name
• Your affiliation at the time of submission
• Your current affiliation
• Your mail address at the time of submission
• Your current mail address
• The date, month and/or year, when you submit your data
• Tool that you used to submit your sequence
• Your sequence(s) (if many, just a few representatives)
• Biological feature of your sequence

When we can not find your data, we will ask you to submit your data as new one.

See "Why is the hold-date required?". Please specify the date.
Though DDBJ does not restrict the date, we strongly recommend to specify the date within two years.
If not specified, the data will be published, immediately.

After data submission, you can change the hold date as needed.
Contact us from this form by selecting "Change the hold-date" in [Subject].

References

How to postpone the hold date?

Principle of “Hold-Until-Published” data release

There are some possibilities as followings.

1) In case of the meantime of data distribution:

The data may be on the process of data distribution. If you are unable to retrieve the data longer than a week, please send an inquiry including the accession number to

2) The specified hold date of the data is in holidays of DDBJ:

We will release the data after holidays of DDBJ. See also DDBJ Calender.

3) In case of not yet confirmed the accession number is published on a paper or others:

Please let us know the paper or other media in which the accession number is described.

4) In case of the data submitted BEFORE January 1, 1998:

The sequence data be still unpublished after hold date.

In case of 3) or 4), we will check and support it.
Please contact us from contact form by selecting the item, "Updating Submitted Data" with accession numbers, or by mail to.

References

Principle of "Hold-Until-Published" data release

Can not find the sequence data, though the accession number cited on a paper.

If you set the hold date for your data, the data will be published according to Principle of “Hold-Until-Published” data release.
After setting to publish the data, the mail with "[DDBJ] Publicized your data" in its subject is sent to contact person.
So, Do not block E-mails from DDBJ.

If the information of contact person is old or invalid, we may be unable to acknowledge publication of your data or any other important announcement.
Contact us from this form to send request by selecting the subject, "Change the contact person, belonging, institution, etc..".

INSD; International Nucleotide Sequence Database are composed of DDBJ, ENA and NCBI, and collect experimentally determined nucleotide sequence data.
A unique accession number issued by INSD for each submitted sequence data is defined as the INSD accession number.
On DDBJ flat file, the accession number is described in ACCESSION line.

If multiple entries are united to an entry, or if an entry is extensively modified after the submission, the responsible data banks may assign a new accession number to it. In these cases, the new accession number is called the primary accession number, and the old accession number(s) is/are called the secondary accession number(s).

In the flat file, the primary accession number is indicated first, then the secondary accession number(s) follows.

example
ACCESSION   AB999999 AB888888 AB777777

AB999999 -- primary accession number

AB888888 AB777777 -- secondary accession number

You can find the same updated entry with both the primary and the secondary accession numbers, in general.
However, if the old entry with secondary accession number has previously been open to the public, the old one is not removed. So, you can find the old record by getentry.

References

getentry HELP

INSDC Status Document: Replaced

Why is the retracted data still available?