ClustalW is a general purpose multiple sequence alignment program for DNA or proteins.
DDBJ provides both the latest version and the DDBJ original version (Version 1.83, Modified by Dr. Kirill Kryukov) .
- Sequence Input
- Pairwise Alignment Options
- Multiple Sequence Alignment Options
- DDBJ Original version (Version 1.83, Modified by Dr. Kirill Kryukov) options
- How to see the result screen
- How to view the results after closing the window
Version
Select "2.1" (Latest version) or "1.83"( DDBJ original, modified by Dr. Kirill Kryukov). Default is Latest version .
In the "1.83", you can specify the detailed option parameters for Tree calculation and Boostrap.
Sequences
Sequence Type
Select Protein or DNA to align. Default value is Protein.
Sequence Input
Enter or paste a set of sequences, or upload a file in any format (NBRF-PIR,EMBL-SWISSPROT, Pearson (Fasta), Clustal (*.aln), GCG-MSF (Pileup), GCG9-RSF, and GDE .
| Available sequence formats |
|
NBRF-PIR EMBL-SWISSPROT Pearson (Fasta) Clustal (*.aln) GCG-MSF (Pileup) GCG9-RSF GDE |
Example (FASTA-Pearson)
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
>my query sequence 2
GGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCGCTTCCCAGGCAACCTGCCTCACATG
CTTCGAGACCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAG
CTGGACAACATATTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAG
>my query sequence 3
ATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCAAC
TTTGCCCACGGACACAACTGCCATATCGCCTTACGGGAGATCATCGAAACTCTGAACAGC
CTCACAGAGCAGAAGACTCTGTGCACCAAGTTGACCATAACGGAC
Pairwise Alignment Options
Alignment Type
The alignment method used to perform the pairwise alignments used to generate the guide tree. Default value is slow.
| Type | Description |
| slow | fine for short sequences but will be very SLOW for many long sequences. |
| fast | FAST, but approximate |
Slow/Fast Pairwise Alignment Options
DNA /Protein Weight Matrix
Slow pairwise alignment DNA/Protein sequence comparison matrix series used to score alignment.
| Protein Weight Matrix (Default value is Gonnet ) | |
| Gonnet | These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set. They appear to be more sensitive than the Dayhoff series. |
| BLOSUM | These matrices appear to be the best available for carrying out data base similarity (homology searches). |
| PAM | These have been extremely widely used since the late '70s. They are also called Dayhoff's matrix. |
| ID | This matrix gives a score of 1.0 to two identical amino acids and a score of zero otherwise. |
| DNA Weight Matrix (Default value is IUB) | |
| IUB | This is the default scoring matrix used by BESTFIT for the comparison of nucleic acid sequences. X's and N's are treated as matches to any IUB ambiguity symbol. All matches score 1.9; all mismatches for IUB symbols score 0. |
| ClustalW | Matches score 1.0 and mismatches score 0. All matches for IUB symbols also score 0. |
GAP OPEN
Gap opening penalty for Slow Pairwise Alignment.
Default value is 10
GAP EXTENSION
Gap extension penalty for Slow Pairwise Alignment. Default value is 0.1
KTUP (WORD SIZE)
Size of exactly matching fragment that is used. Increase for speed, decrease for sensitivity. Default value is 1
WINDOW LENGTH
number of diagonals around each of the 'best' diagonals that will be used. Decrease for speed; increase for sensitivity. Default value is 5
SCORE TYPE
Score type to output. Default value is percent.
TOPDIAG
Number of k-tuple matches on each diagonal. Decrease for speed; increase for sensitivity. Default value is 5
PAIRGAP
Fast pairwise alignment gap penalty for each gap created. Default value is: 3
Multiple Sequence Alignment Options
Alignment Options
| Protein Weight Matrix (Default value is Gonnet ) | |
| Gonnet | These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set. They appear to be more sensitive than the Dayhoff series. |
| BLOSUM | These matrices appear to be the best available for carrying out data base similarity (homology searches). |
| PAM | These have been extremely widely used since the late '70s. They are also called Dayhoff's matrix. |
| ID | This matrix gives a score of 1.0 to two identical amino acids and a score of zero otherwise. |
| DNA Weight Matrix (Default value is IUB) | |
| IUB | This is the default scoring matrix used by BESTFIT for the comparison of nucleic acid sequences. X's and N's are treated as matches to any IUB ambiguity symbol. All matches score 1.9; all mismatches for IUB symbols score 0. |
| ClustalW | Matches score 1.0 and mismatches score 0. All matches for IUB symbols also score 0. |
GAP OPEN
Multiple alignment gap opening penalty. Default value is 10
GAP EXTENSION
Multiple alignment gap extension penalty. Default value is 0.20
GAP DISTANCES
Multiple alignment gaps that are closer together than this distance are penalised. Default value is 5
NO END GAPS
Multiple alignment disable the gap seperation penalty when scoring gaps the ends of the alignment. Default value is no
| Type | Description |
| no | false |
| yes | true |
ITERATION
This can be used to improve the final alignment or improve the alignment at each stage of the progressive alignment. Default value is none
| Type | Description |
| none | No iteration |
| tree | Iteration at each step of alignment process |
| alignment | Iteration only on final alignment |
NUMITER
Maximum number of iterations to perform. Default value is 1
CLUSTERING
Clustering type. Default value is NJ
| Type | Description |
| NJ | Neighbour-joining (Saitou and Nei 1987) ) method |
| UPGMA | Unweighted Pair-Group Method with Arithmatic mean method |
Output Options
Format
Format for generated multiple sequence alignment. Default value is Aln w/numbers
| Type | Description |
| Aln w/numbers | Residue numbers may be added to the end of the alignment lines in clustalw format. |
| Aln wo/numbers | Residue numbers may not be added in clustalw format. |
| GCG MSF | GCG MSF |
| PHYLIP | PHYLIP interleaved alignment format |
| NEXUS | NEXUS format |
| NBRF/PIR | NBRF/PIR format |
| GDE | GDE format |
| Pearson/FASTA | Pearson / FASTA format |
Order
Control the order of the sequences in the output alignments.. Default value is aligned
| Type | Description |
| aligned | Corresponds to the order in which the sequences were aligned (from the guide tree-dendrogram), |
| input | Same order as the input sequences |
DDBJ Original version (Version 1.83, Modified by Dr. Kirill Kryukov) options
Tree calculation ·BOOTSTRAP options
Distance
pecify the correction format. Default value is Kimura. Only Kimura and p-distance can be specified for PROTEIN. The options marked * are DDBJ's original option formats.
| Method | Model | Note | |||||||||||||||||||||||||
| Kimura |
|
Distance estimated by assuming that the rates of transition and transversion are different. | |||||||||||||||||||||||||
| p-distance | Proportion of difference | ||||||||||||||||||||||||||
| Jukes-Cantor* |
|
Distance estimated by assuming that all types of substitutions occur at the same rate | |||||||||||||||||||||||||
| Tamura* |
|
Distance estimated by assuming that the rates of transition and transversion are different, and taking into account the equilibrium frequencies of GC. | |||||||||||||||||||||||||
| Tajima-Nei* |
|
Distance estimated by taking into account the equilibrium frequencies of T, C, A, and G. | |||||||||||||||||||||||||
| Gojobori-Ishii-Nei* |
|
Distance estimated by assuming that the rates are different not only for substitutions between GC and TA, but also for others. | |||||||||||||||||||||||||
| Tamura-Nei* |
|
Distance estimated by assuming not only that the rates of transition and transversion are different but also the rates between TC and AG are different, and taking into account the equilibrium frequencies of T, C, A, and G. | |||||||||||||||||||||||||
|
|||||||||||||||||||||||||||
TOSSGAPS
Specify ignore positions with gaps. Default is ON.
OUTPUTTREE
Specify the output format (options are phylip, nj and plylip distance). Default is phylip.
COUNT
Specify number of bootstraps. Default:1000 Range:1-10000
SEED
Specify seed number for bootstrap. Defalut:111 Range:1-1000.
Method of phylogenetic tree
Methods for constructing the phylogenetic tree using the nucleotide or amino acid sequences may largely be classified into the distance-matrix methods and the character-state methods. In the distance-matrix method, the distance matrix, which consists of evolutionary distances (number of nucleotide or amino acid substitutions) between all possible pairs of sequences analyzed, is generated, and the phylogenetic tree fittest to the matrix is chosen. On the other hand, in the character-state method, the sequences are compared directly, and the phylogenetic tree fittest to the assumed pattern of nucleotide or amino acid substitution is chosen
In CLUSTALW, the phylogenetic tree is constructed by using the neighbor-joining (NJ) method, which belongs to the distance-matrix method. When the nucleotide sequences are analyzed, the p distance method, Kimura method, Tamura method, Tajima-Nei method, Gojobori-Ishii-Nei method, Tamura-Nei method, and so on, are available for estimating the number of nucleotide substitutions between sequences. These methods are different in the pattern (model) of nucleotide substitution assumed for estimating the evolutionary distance.
Generally, the bases T (U) and C have a pyrimidine, and A and G have a purine in their chemical structure, and the physicochemical properties are similar within each group. In fact, the rates of nucleotide substitution between T and C and between A and G (transitions) are empirically known to be greater than those of the other types of substitutions (transversions). In addition, since the equilibrium frequencies of T, C, A, and G are usually different in a genome, the rate of nucleotide substitution appears to be dependent on the frequency of the base to which the original base is substituting. Another mechanisms are also considered to make the rate of each nucleotide substitution (T -> C, A -> G, etc.) different.
These arguments suggest that assuming complex patterns of nucleotide substitution allows for accurate estimation of the numbers of nucleotide substitutions. However, the more complex models contain a greater number of parameters to be estimated, and the variances (standard errors) of the estimates become larger as the number of parameters increases. Since the parameter values are estimated from the sequence data analyzed, the accuracy of the estimates depends on the number of sequences, sequence length, and sequence divergence, etc. Therefore, the pattern of nucleotide substitution suitable for the analysis of sequences depends on the sequence data analyzed, and some methods are available for finding the fittest model for given sequence data.
In CLUSTALW, the default method used for estimating the number of nucleotide substitutions is the Kimura method, because this method is one of the most widely used methods. However, if the fittest model to the sequence data analyzed is different from the Kimura model, it is possible that incorrect results are obtained. In such cases, it may be useful to try another models in the analysis.
Similarly, the p distance method and Kimura method are available for estimating the number of amino acid substitutions between sequences in CLUSTALW. (Here the Kimura method for estimating the number of amino acid substitutions is totally different from the Kimura method for estimating the number of nucleotide substitutions.) The default method is the Kimura method, but the p distance method may also be useful for some data.
How to see the result screen
ClustalW analysis result
(1)Result

(2) Multiple Alignment

(3) Guide Tree

(4) Bootstrap analysis

(Note)Since April 2012, in the ClustalW ver.2.1, BOOTSTRAP is calculated automatically and ".phb" download file is placed, except for the following combination of [FORMAT] and [Clustering] options.
| [FORAMT] | [CLUSTERING] |
| PHYLIP | NJ |
| NEXUS | NJ |
| PHYLIP | UPGMA |
| NEXUS | UPGMA |
- 1) Right-click on the following links, and add bookmark or favorite.
- 2) Select the text part of the appropriate accession number, and call up the bookmark.
(5) Phylogenetic Tree Drawing

By opening the ".phb" file by the Tree Drawing Program (e.g.: TreeView), phylogenetic tree is print in the screen.
How to view the results after closing the window
Using the Request ID, ClustalW analysis result is available by the following URL.
Request ID is shown in the screen after submitting the query.
http://clustalw.ddbj.nig.ac.jp/cgi-bin/clustalwr.cgi?id=Request ID&output=aln1
Please note that whoever knows Request ID can view the result.
About ClustalW
This program is : ClustalW2.1
References
- Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG.
(2007). Clustal W and Clustal X version 2.0. Bioinformatics, 23, 2947-2948. - Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. (2003) Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31(13):3497-500.
- Thompson JD, Higgins DG, Gibson TJ. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22(22):4673-80.
