Last updated:2017.12.13.

Protein Coding Sequence; CDS feature


One of the most frequently used feature keys is "CDS" to describe coding sequence for protein. The location of CDS feature basically indicates the base range(s) from the start point of initiation codon to the end point termination codon location. CDS feature indicates the amino acid translation with codon table (indicated by transl_table qualifier) of the source organism and the description of the frame codon_start and transl_except, on the basis of the information provided from submitter (In the case of setting the qualifier, pseudo or pseudogene, translation is NOT indicated).

Some qualifiers are also described to indicate the product name and/or function of the corresponding protein on the basis of the information provided from submitter. If the information is confirmed experimentally, experiment qualifier can be described. In the case of the predicted information by the homology of the sequence etc., inference qualifier can be described.

Since the criteria of similarity and homology is not defined in the international nucleotide database, whether the gene is a homolog of some other gene(s) or not is judged by submitters, entirely.In principle, the information about motif and higher-order structure of protein is NOT described on the flat file.


Gene nomenclature at DDBJ

DDBJ does not have any right for the gene nomenclature. Also, DDBJ does not make any official collaboration with any committee of gene nomenclature. If there is no particular incident, the descriptions related to gene nomenclature are described as provided by submitter.

DDBJ recommends to describe 'symbolic ID of locus' in gene qualifier, and the name of protein product in product qualifier.

DDBJ also recommends to use the comprehensible description for product, because the value for product qualifier is frequently use for the summary information in many result logs of similarity searches or some other retrieval systems.

DDBJ policies for the descriptions of gene and product are follows, though they have no binding force to submitters;

  • The descriptions of items should be reflected submitter's scientific claims.
  • As far as along with submitter's opinions, names of 'gene' and 'product' should be in common with previous reports in reference databases.
  • The name of 'gene' should be assigned for each locus.
  • The name of 'product' should be assigned for each protein product.

For user's convenience to refer contents of database, DDBJ recommends to describe the names of gene and product as follows;

gene: symbol of the gene corresponding to a sequence region
Example: ilvE

  • Please enter the abbreviation as gene symbol.
  • Even if there are multiple general abbreviations for the same gene, do not enter multiple abbreviations in 'gene'.
    Do not use needless symbolic letters as delimiter for multiple names. If you would like to describe more than two, please enter one of the most representative abbreviation in 'gene', and other(s) in 'gene_synonym' qualifier.
product: name of the product associated with the feature, e.g. the polypeptide of a CDS
Example: trypsinogen

  • In principle, please enter a general name, not abbreviation.
  • Do not include the organism name.
  • Even if there are multiple general names for the same product, do not enter multiple names in 'product'.
    Do not use needless symbolic letters as delimiter for multiple names.
    If you would like to describe more than two names, please enter one of the most representative name in 'product',and other(s) in 'note' qualifier.
  • If the name and function are not known, we recommend to describe as "hypothetical protein".

Though we recognize that there are many exceptions in which the gene nomenclature of some model organisms do not fall into the above rule, we recommend the above rule, because we wish to make contents of DDBJ/EMBL/GenBank as useful as possible.

Please do not hesitate to contact us when you like to update the informnation of protein in your entry after once submitted to DDBJ. See also the page, Data Updates/Correction: after getting your accession number, when you like to update your data.


How to describe CDS feature, when termination codon is found in the range

When you find termination codon(s) in the range of CDS feature that you presume, at first, please confirm that following items are appropriately specified.

If all of above items are correct and termination codon is still found in the range of CDS feature, it should be processed by either of following ways, in principle.


a) Putative nonsense mutation, frameshift caused by uncertain reason, or on the process of diversity increasing related to acquired immunity for IgG etc.

In case of low accuracy of sequencing, use this solution, in principle.

Describe with misc_feature, not CDS.

Because it is not sure if the corresponding protein exist or not.
Describe referred information in inference qualifier.
Describe a short explanation in note qualifier; "putative frameshift mutation", "Ig rearrangement", "TCR beta rearrangement" or else.


b) considered pseudogene

If you have not yet confirmed any collateral evidence to identify a pseugdogene (i.e. relationship of orthologues and paralogues in other species, missing any corresponding transcript, or some), you shuold not call it pseudogene.

Describe original CDS location with pseudogene qualifier.

When you use pseudogene qualifier, translation is not described for the CDS feature, because the corresponding protein would not exist in vivo.

See also Example of Submission B06.


c) In case that you assume that the truncated protein exists in vivo

Describe CDS location corresponding to the truncated protein.
i.e. The CDS location should be shortened.


d) ribosomal slippage

Adjust CDS location with "join" operator at the point of ribosomal slippage.

In case of + 1 frameshift at the 90th base
     CDS             join(21..90,90..449)
In case of - 1 frameshift at the 91st base
     CDS             join(21..90,92..451)

Then, add ribosomal_slippage qualifier as a flag to indicate the adjustment is legal.
After this adjustment of location, the amino acid sequence in translation qualifier is conceptually translated one.
See also Example of Submission B10.

On submission via Nucleotide Sequence Submission System, please use "Submission Information" box to tell us the ribosomal slippage in detail.


e) RNA editing

Basically, it should be described for genome annotation.

Describe original CDS location with exception qualifier.

When the exception qualifier is described, amino acid sequence for translation qualifier can be provided by submitter. So, you can use the amino acid sequence confirmed via cDNA or some for the CDS feature on the genomic sequence.
Describe referred information in inference qualifier.
See also Example of Submission B09.

On submission via Nucleotide Sequence Submission System, please use "Submission Information" box to tell us translational exceptions in detail.


f) translated with selenocystein or pyrrolysine

Describe original CDS location with transl_except qualifier.

For example;
    # To use "U" (one letter abbreviation for selenocystein) for amino acid translation
    # To use "O" (one letter abbreviation for pyrrolysine) for amino acid translation


g) gene disruption by transpon insertion etc.

Describe with misc_feature, not CDS.


h) low accuracy of draft sequences from genome or transcriptome project

To avoid the point of frameshift, adjust CDS location with "join" operator, operatively, to make amino acid sequence with conceptual translation.
Add artificial_location qualifier as a flag to indicate the operative adjustment.

For submissions via Nucleotide Sequence Submission System, it is forbidden to use artificial_location qualifier.


Locations with "join" operators are basically described to indicate splicing results

In general, the rule about description of location for CDS is in common with all other features.
See Description of Location in detail.

In general, on prokaryotic genome or mature mRNA, the location of CDS feature should be described as a simple span, so, there is no need to use "join" operator.

In case of using a 'join'ed location for CDS feature, it should indicate how to conjugate exons specified in the genomic sequence each other, on the process of mRNA maturation. Basically, we can not accept any CDS feature with 'join'ed location other than to indicate splicing pattern of the CDS.

However, there are three major exceptions as below;

  • On the circular genome sequence, to indicate the conjugation of the end of the sequence and the start of it
  • For viruses or some, to indicate ribosomal slippage is occured in the process of translation.
  • CDS locations operatively adjusted to avoid frameshift errors in draft sequences from genome or transcriptome projects, with a flag artificial_location qualifier.


Translated amino acid sequence described at translation qualifier

For example, in the page, Explanation of DDBJ flat file format, the amino acid sequence in the value of translation qualifier is processed from the nucleotide sequence by using following items;

     CDS             86..>450
  • CDS   86.. >450 -- The region from 86th to 450th base of the sequence is coding a protein described with following qualifiers.
    ">" means that 3'end is not completed for the region of CDS.
    See the rule for Description of Location in detail.

  • /codon_start=1 -- The frame reading amino acid translation of the first codon is the 1st base of the above CDS location (86th base of the entry).

  • /transl_table=1 -- The nucleotide sequence of CDS region is translated into amino acid sequence according to The Genetic Codes, No. 1 table.

Acording to above items, the region from 86th to 450th bases of the nucleotide sequence is translated into the amino acid sequence as with 1 letter abbreviation below;

      86 atg gcg aag att aag atc ggg atc aat ggg ttc ggg agg atc ggg 
     aa: M   A   K   I   K   I   G   I   N   G   F   G   R   I   G   

     131 agg ctc gtg gcc agg gtg gcc ctg cag agc gac gac gtc gag ctc 
     aa: R   L   V   A   R   V   A   L   Q   S   D   D   V   E   L   
     176 gtc gcc gtc aac gac ccc ttc atc acc acc gac tac atg aca tac 
     aa: V   A   V   N   D   P   F   I   T   T   D   Y   M   T   Y   

     221 atg ttc aag tat gac act gtg cac ggc cag tgg aag cat cat gag 
     aa: M   F   K   Y   D   T   V   H   G   Q   W   K   H   H   E   
     266 gtt aag gtg aag gac tcc aag acc ctt ctc ttc ggt gag aag gag 
     aa: V   K   V   K   D   S   K   T   L   L   F   G   E   K   E   

     311 gtc acc gtg ttc ggc tgc agg aac cct aag gag atc cca tgg ggt 
     aa: V   T   V   F   G   C   R   N   P   K   E   I   P   W   G   
     356 gag act agc gct gag ttt gtt gtg gag tac act ggt gtt ttc act 
     aa: E   T   S   A   E   F   V   V   E   Y   T   G   V   F   T   
     401 gac aag gac aag gcc gtt gct caa ctt aag ggt ggt gct aag aag 
     aa: D   K   D   K   A   V   A   Q   L   K   G   G   A   K   K   
     446 gtc tg 
     aa: V   ?


The last two bases, "tg", can not be specified to be traslated into either of amino acids, C (cysteine), W (tryptphan), or * (termination codon), so, it is not described.
Finally, the translated amino acid sequence is described in the value of translation as below.



Offset of the frame at translation initiation by codon_start

The codon_start qualifier indicates the offset at which the first complete codon of a CDS feature can be found, relative to the first base of that feature.

When the location of CDS feature is started from initiation codon, the value of codon_start is 1, consistently.

If the location of CDS feature is not started from initiation codon, codon_start is required to specify from either of 1, 2, or 3, appropriately.
Although the nucleotide sequence is same, depending on the description of codon_start, translated amino acid sequence is different as followings.

    the number of base position: tens place           11111111112222222 
    the number of base position: ones place  12345678901234567890123456 
    nucelotide sequence                      ttcggctgcagaagataaataaataa 
    translated amino acid sequence, case 1   F  G  C  R  R  *  
    translated amino acid sequence, case 2    S  A  A  E  D  K  *  
    translated amino acid sequence, case 3     R  L  Q  K  I  N  K  *  
case 1
    CDS     <1..18
case  2
    CDS     <1..22
case  3
    CDS     <1..26