Last updated:2014.11.7.

transChecker User’s Manual


What is transChecker?

transChecker is a software tool developed by DDBJ for checking translation into amino acid sequence from CDS features that are described in annotation and sequence files. Both annotation and sequence files are required to submit nucleotide sequences to DDBJ.
Please refer to Making MSS Files, when you prepare the two files.
These files should be checked with Parser tool before using transChecker.


How to use transChecker?

Before using this software, please confirm End-user license agreement, carefully.


Formats of transChecker outputs

The transChecker outputs translated amino acid sequences and error messages.


Format of amino acid sequences

The transChecker provides two options for translated amino acid sequences.
Even though some errors are occurred, the sequence of CDS feature is translated into amino acid as is, however, some translation processes are likely skipped because of severe errors.


FASTA-like format

The amino acid sequences are in a kind of fasta format as follows.

>[Entry name].[Serial number of CDS feature][Space][Location of CDS feature]
[Amino acid sequence (60 letters/line)]
For example
>entry1.1 89..406
>entry1.2 684..1325


Alignment with nucleotide sequence

The alignments for nucleotide and translated amino acid sequences are in the following format.

>[Entry name].[Serial number of CDS feature][Space][Location of CDS feature]
/codon_start=[value of codon_start; in case of null, 1]
/transl_table=[value of transl_table; in case of null,1]
[Nucleotide number][Nucleotide sequence (60 letters/line)]
[Amino acid number][Amino acid sequence (20 letters/line)]
For example
>ENT01.1 <1..179
         1 tgtacccactcaattttgtaaccccgggtatcatgctcccaggtgcattgatgttggatt
         1   Y  P  L  N  F  V  T  P  G  I  M  L  P  G  A  L  M  L  D  F

        61 tcacgatgtatctgacgcgtaactggctggtgaccgcattggttggaggtggattctttg
        21   T  M  Y  L  T  R  N  W  L  V  T  A  L  V  G  G  G  F  F  G

       121 gtctgctgttttacccaggtaactggccaatctttggcccgacccatctgccaatctaa
        41   L  L  F  Y  P  G  N  W  P  I  F  G  P  T  H  L  P  I  
>ENT02.1 101..280
         1 atgtacccactcaattttgtaaccccgggtatcatgctcccaggtgcattgatgttggat
         1 M  Y  P  L  N  F  V  T  P  G  I  M  L  P  G  A  L  M  L  D

        61 ttcacgatgtatctgacgcgtaactggctggtgaccgcattggttggaggtggattcttt
        21 F  T  M  Y  L  T  R  N  W  L  V  T  A  L  V  G  G  G  F  F

       121 ggtctgctgttttacccaggtaactggccaatctttggcccgacccatctgccaatctaa
        41 G  L  L  F  Y  P  G  N  W  P  I  F  G  P  T  H  L  P  I  


Format of transChecker error messages

If there is no error, this tool does not dump any error messages.
When some errors are found, it is required to correct and to fix them before your submission.
See List of transChecker error messages for each error message outputted by transChecker in details.

Error messages are described in the following format.

>[Entry name].[Serial number of CDS feature][Space][Location of CDS feature]
[Code Number]:[Level]: [Body Text]
[Code Number]:[Level]: [Body Text]
[Code Number]:[Level]: [Body Text]

[Code Number]:[Level]: [Body Text]

Code Number; Indicate the code number of the message
Level; Indicate the level of the message;
ER2; Type 2 error of the file format. Correction is required.
FAT; Fatal error, related to system environment.
WAR; Warning for the file format. Correction is sometimes required.
Body Text; Detail descriptions of the message
For example
>entry1.1 <1..>366
TC0020:WAR: [codon_start] qualifier should be selected. The value is automatically set 1. 
TC0020:WAR: [transl_table] qualifier should be selected. The value is automatically set 1. 
>entry2.3 4315..4997
TC0017:ER2: First codon [cct] is not a start codon.
TC0018:ER2: Final codon [cat] is not a stop codon.
TC0019:ER2: Stop codon is found in mid of CDS location.