Variable record

The unique information and nucleotide sequence of the entry is described in the resource unit.

Format of variable record

One entry is consisted of "Header" line and nucleotide sequence.Header line starts ">" and follows six items related to each entry.Six items are delimited by "|"(pipe).

>[ACC#]|[submitter's identifier]|[number of sequence count]|[map]|[free text]|[db_xref1(,db_xref2,...)]|

[ACC#] －－ accession number of the entry

[submitter's identifier] －－- identifier assigned by submitter to the entry

[number of sequence count] －－ number of the count of this entry in the resouce

[map] －－ map information

[free text] －－ free-text-formatted description of the entry

[db_xref1(,db_xref2,...)] －－ external database information of the entry

The related information of an entry can be changed, but revise of nucleotide sequence can not be allowed. If the sequence which has already been submitted into INSDC is taken from identical resource, the item, [number of sequence count] of the entry has to be updated.

example
>ZZZZZ0000001|ABC1004AA60F1902|100|9B|lipidosis-related protein Lipidosin| MGI:2385656|
gactgtcttcggtgaatgca

ZZZZZ0000001 －－ Accession number

ABC1004AA60F1902 －－ Submitter's identifier

100 －－ Number of sequence count

9B －－ Map location (in this case, chromosome number)

lipidosis-related protein Lipidosin －－ Submitter's description about the sequence; match to 5'end of mRNA sequence encoded "lipidosis-related protein Lipidosin" (AB050554)

MGI:2385656 －－ external database information of the entry

gactgtcttcggtgaatgca －－ Nucleotide sequence of the sequence