Enter nucleotide sequence.
Assembly information is also needed for the case of TPA
Nucleotide sequence that you can paste/upload
for TPA submission
Format of assembly Information for TPA submission
Rule of the form of Assembly Information
How to suspend/resume the submission
Nucleotide sequences that you can paste or upload
You can paste or upload nucleotide sequence consists of multi-FASTA format.
Double slash(//) is not needed for separate the entries. Of course, you can include double slash (//) as a separation mark of the entries.(e.g.1 & e.g.2)
This system automatically insert double slash (//) between entries when the nucleotide sequence that contains no double slash (//) is entered.
Entry name is required to be described in less than 24 letters of characters which do not contain [space], "
[double-quote], ? [question], \, [back-slash].
Entry names must be unique in one submission.
If the same entry name are contained in the submission, you must correct the entry name to avoid an error.
The sequence must consists of a, c, g, t, m, r, w, s, y, k, v, h, d, b, or n.
Spaces, numeric characters within the nucleotide sequence are automatically removed.
Upper cases of the nucleotide residue id automatically converted into lower cases.
e.g.1 >CLN01 ggacaggctgccgcaggagccaggccgggagcaggtggtggaagacagacctgtaggtgg aagaggcttcgggggagccggagaactgggccagaccccacaggtgcaggctgccctgtc tgcgcttcagtcgtgggcgaagcctgaggaaaaagagagagaggctcaaggaagagagga tgaggcaggagaatcgcttgaaccccggaggcggaggttgcagtgagccgagattacgcc accgcactccagcctgggcgacagagtgagactccatctcaaaaaaaaaaaaaaaaaa >CLN02 ctcacacagatgctgcgcacaccagtggttgtaacaatgccgtttgcctccttcaggtct gaagcctgaggtgcgctcgtggtcagtgaagagggcaaaaagagagagaggctcaaagga tgcgcttcagtcgtgggcgaagcctgaggaaaaagagagagaggctcaaggaagagagga tagtcattcatataaatttgaacacacctgctgtgcctagacaagtgtctttctgtaaga gctgtaactctgagatgtgctaaataaaccctctttctcaaaaaaaaaaaaaaaa
e.g.2 >CLN01 ggacaggctgccgcaggagccaggccgggagcaggtggtggaagacagacctgtaggtgg aagaggcttcgggggagccggagaactgggccagaccccacaggtgcaggctgccctgtc tgcgcttcagtcgtgggcgaagcctgaggaaaaagagagagaggctcaaggaagagagga tgaggcaggagaatcgcttgaaccccggaggcggaggttgcagtgagccgagattacgcc accgcactccagcctgggcgacagagtgagactccatctcaaaaaaaaaaaaaaaaaa // >CLN02 ctcacacagatgctgcgcacaccagtggttgtaacaatgccgtttgcctccttcaggtct gaagcctgaggtgcgctcgtggtcagtgaagagggcaaaaagagagagaggctcaaagga tgcgcttcagtcgtgggcgaagcctgaggaaaaagagagagaggctcaaggaagagagga tagtcattcatataaatttgaacacacctgctgtgcctagacaagtgtctttctgtaaga gctgtaactctgagatgtgctaaataaaccctctttctcaaaaaaaaaaaaaaaa //
for TPA submission
Nucleotide sequences that you can paste or upload
Format of assembly Information for TPA submission
Rule of the form of Assembly Information
How to suspend/resume the submission
Format of assembly Information for TPA submission
e.g.
You can download the assembly sample from here (tab-deliminated text format).
As for Entry name FA01;
TPA sequence:1-552 corresponds to ZZ000001.1:54872-55422
TPA sequence:553-705 corresponds to ZZ000002.5:1-153
As for Entry name BM123;
TPA sequence:1-438 corresponds to ZZ000010.1 :1-438
TPA sequence:377-695 corresponds to ZZ000011.1:complement(1-320)
TPA sequence:411-790 corresponds to ZZ000021.12:1-398
TPA sequence:790-1191 corresponds to ZZ000022.0 :1-401
Their correspondence is subject to the rule, "The sequence alignment rule between TPA and primary entries".
Rule: Description of Assembly Information
- The 1st line must be
[tab or space]TPA_SPAN[tab or space]PRIMARY_IDENTIFIER[tab or space]PRIMARY_SPAN[tab or space]COMPLEMENT
- Do not include null line(s)
- Entry name must be entered at the 1st column. Assembly information is separated with each entry at the line of entry name.
- TPA_SPAN:
X..Y or X-Y (X and Y are numeric, X<Y)
Location on TPA sequence is described.
e.g.
100..2000
100-2000
- PRIMARY_IDENTIFIER:
accession number.version
Accession number with version of primary entry is described. Please use 0 for the version number if primary entry is not released.
e.g.
AB123456.1
AB987654.0
- PRIMARY_SPAN:
X..Y or X-Y (X and Y are numeric, X<Y)
The region from primary entry, which was used for construct TPA sequence, is described. The region must match to the TPA_SPAN.
Please see "The sequence alignment rule between TPA and primary entries"
- COMPLEMENT:
null or c
Enter "c" when complementary region is used from primary entry.


