Data Updates/Corrections: after getting your accession number

Please send request to ddbjupdt#64;ddbj.nig.ac.jp

Making requests
We only accept updating requests from the original submitter of the entry.
Therefore if you are not the submitter you will need authorization from the submitter before making requests for the entry.
Accepting your requests
We will send you a E-mail when your request is accepted.
We will contact you only if we have queries or require further information.
"Question and Answer" style
Follwing items are constructed in "Question and Answer" format.
Please use these help items as the samples for your update request.

When our paper was published, what should I do?

Please use this form to send request with the following contents in clear English.

  • All accession numbers:
  • Title:
  • All authors:
  • Journal name:
  • Volume / start page / end page / year:

When our paper was accepted, what should I do?

Please use this form to send request with the following contents in clear English.

  • All accession numbers:
  • Title:
  • All authors:
  • Journal name:
  • Release or Private:

On the process of submission of a paper to a journal, we have to show the referee our nucleotide sequence submitted as "Hold-Until-Published" status...

DDBJ does not provide any procedure for a limited disclosure by the passwor authentication or else. When you have to show your sequences submitted with"Hold-Until-Published" status for only particular individuals, you can send a text file including your sequences to them.
If the referee wish to confirm the condition and/or the descriptions of your sequence submission, you can choose either of the following two procedures;

a) Publicize your sequences through DDBJ.
If you do not mind to open your sequences to the public, please send us your request to publicize your submitted sequences with all of accession numbers.
b) Send DDBJ flat files of your submission to the referee, directly
When the submitter requests to us, we send the text file including DDBJ flat files to the submitter. So, please send us your request with all of accession numbers to get DDBJ flat file(s) of your submission. Then, you can forward the text file to the referee.

How to change the contact person, belonging, institution, etc..

Please use this form to send request with the following contents in clear English.

  • All accession numbers:
  • The full name of NEW contact person (in case of changing it.):
  • The full name of OLD contact person (in case of changing it.):
  • NEW Institution (in case of changing it.):
  • OLD Institution (in case of changing it.):
  • NEW Address (in case of changing it.):
  • OLD Address (in case of changing it.):
  • NEW E-mail address (in case of changing it.):
  • OLD E-mail address (in case of changing it.):
  • NEW Phone number (in case of changing it.):
  • OLD Phone number (in case of changing it.):
  • NEW Fax number (in case of changing it.):
  • OLD Fax number (in case of changing it.):

How to update our sequence?

Please send your request to ddbjupdt#64;ddbj.nig.ac.jp with the following contents in clear English.

  • Accession numbers:
  • The modified part:
  • Total base count:
  • Other modified feature:
  • Updated sequence in full length: Please use the following format.
>AB*****1
aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt
ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc
//
>AB*****2
aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt
ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc
aaaaaaaaaat
//

The first line begins with ">", and is followed immediately by the accession number, then line break. Each line must be 60 letters or less, line break at each line end, and must have "//" on the last line.

If you are making update request for large number of entries, or major changes of your data, please consult DDBJ in advance.

How to postpone the hold-date?

Please use this form to send request with the following contents in clear English.

  • Accession numbers:
  • New hold-date: (e.g. 2009/06/25)

How to update many entries with a number of corrections?

Requesting updates for a large number of entries or feature changes due to
the sequence correction, please read below.

(1) Update information is in common of all entries.
Example: change reference or submitters information, postpone the hold-date, etc..
(2) Contents of correction differs in every entries.
Example: change each clone or gene name of all entries, etc..
(3) Extensive correction of data
Example: change more than 30 features due to the sequence update, etc..

In case of (1), regardless of the number of entries, please inform us the correction of each data by following the above-mentioned instruction.

In case of (2) and (3), we would like to know the number of entries, the correction item, etc. in advance in order us to specify the format of your sending file.

Please send request to ddbjupdt#64;ddbj.nig.ac.jp
In general, we handle update requests within several days but for a large number of entries, it might take us time in updating the data.

Be sure to contact us beforehand when you request the release of data which accompanies correction.

How to restore the released data to private?

In principle, you cannot remove your sequence data from DDBJ retrieval system: getentry, if it has already been open to the public (If DDBJ wrongly published your data because of any mistakes, the data should be removed as soon as possible.).

However, if there is some specific reason for removing your sequence data (i.e. some error is found, etc.), we can restrict access to your sequence data.

Please send your request to ddbjupdt#64;ddbj.nig.ac.jp with the following contents.

  • Accession numbers:
  • Reason in brief:
  • New hold-date: (e.g. 2010/06/25)

If we restrict access to your sequence data and remove it from the public view, then it will no longer be included in homology search services at DDBJ or distributed as a part of the next DDBJ periodical release. However, it may remain in other third party databases, and will still be retrievable in getentry by accession number based queries.

Moreover, our unified database may be copied and redistributed without permission at any other organizations. In case you need to withdraw your entry from such database, we ask you to make request directly to the organization which manages the database.

I cannot retrieve the data after hold-date.

Please read Principle of "Hold-Until-Published" data release and check the date of your submission.

The principles listed at the site are applied to the submission which were registered at DDBJ AFTER January 1, 1998.

(A) For submission AFTER January 1, 1998:
Your entry is now on the process of annotation.
If you are unable to retrieve the data longer than a week, please send an inquiry including the accession number to ddbjupdt#64;ddbj.nig.ac.jp
(B) For submission BEFORE January 1, 1998:
You may have failed to inform us of the release date and publication.
Please inform us to release the data with your accession number to ddbjupdt#64;ddbj.nig.ac.jp

How to delete my data?

In principle, following two conditions are required to delete your sequence data;

1) The sequence data has not yet been publicized
2) The accession number of the data has not yet been published.

Please send your request to ddbjupdt#64;ddbj.nig.ac.jp with the following contents in clear English.

  • Accession numbers:
  • Reason in brief:

Do I have to send my reprint ?

In principle, we do not need any reprint.
We will contact the submitter and ask for a reprint only if necessary.

 
 
 
 

 
 
 
 

 
 
 
 

 
 
 
 

 
 
 
 

 
 
 
 

 
 
 
 

 
 
 
 

ページの先頭へ戻る