 |
 |
 |
|
|
 |
|
|
 |
 |
|
|
|
 |
|
Contact Us
|
Copyright © 1995-2006
DDBJ All rights reserved. |
|
Human Chromosome 22 Sequence Completed Dec. 10, 1999
- Human genome project teams of US, Europe, and Japan completed the sequence of human chromosome 22 (33.4 million bps).
This chromosome contains 545 genes and 134 pseudogenes, and it is about 1 % of the whole human genome.
Keio University team headed by Professor Nobuyoshi Shimizu, Sanger Centre in U.K., University of Okurahoma and Washington University in U.S.A. determined thosesequences.
- The Keio University team submitted their data to DDBJ, and we released to public in DDBJ/EMBL/GenBank International Nucleotide Sequence Database.
Deinococcus radiodurans was added to GIB Jan. 5th, 2000
- GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of Deinococcus radiodurans were released, we incorporated them to GIB,and now you can search those data.
Human Chromosome 22 Sequence Completed Dec. 10, 1999
- Human genome project teams of US, Europe, and Japan completed the sequence of human chromosome 22 (33.4 million bps).
This chromosome contains 545 genes and 134 pseudogenes, and it is about 1 % of the whole human genome.
Keio University team headed by Professor Nobuyoshi Shimizu, Sanger Centre in U.K., University of Okurahoma and Washington University in U.S.A. determined those sequences.
- The Keio University team submitted their data to DDBJ, and we released to public in DDBJ/EMBL/GenBank International Nucleotide Sequence Database.
- List of the Keio University team's data (90 entries, 5,453,751 bps)
- D86989, D86991, D86993-D86996, D86998-D87000, D87002-D87004,
D87006-D87007, D87009-D87024, D88268-D88271, AP000343-AP000362, AP000365,
AP000522-AP000547, AP000550-AP000558
supernig periodic maintenance Dec. 3rd, 1999
- Supernig service will be unavailable during the following date because of the periodic maintenance.
We appreciate your cooperation.
- Dec. 17 (Fri.) 12:00 - Dec. 18 (Sat.) 14:00
supernig periodic maintenance Nov.11, 1999
- Supernig service will be unavailable during the following date because of the periodic maintenance.
We appreciate your cooperation.
- Nov. 19 (Fri.) 12:00 - 21:00
Announcement about the New Year Holidays of DDBJ Nov.11, 1999
- We at DDBJ will suspend our business during the New Year Holidays in the following schedule.
- We will stop most activities including issuing the accession numbers during that period, and resume the normal business on Jan. 5 , 2000.
- Dec. 24, 1999 (Fri.) 12:00 Stop receiving data
- Dec. 27, 1999 (Mon.) 9:00 Stop all the activities
- Jan. 5, 2000 (Wed.) Resume all the activities
- Thank you for your cooperation. We wish you a Happy New Year.
- DNA Data Bank of Japan
- *National Institute of Genetics computer system will be unavailable from December 27, 1999 to January 4, 2000 so as to avoid any possible problems which may arise due to the so-called Y2K problem.
DDBJ Rel. 39 Completed Nov. 2nd, 1999
- The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media.
We completed DDBJ Release 39 in November 2nd, 1999.
DDBJ Release 39 consists of 4,810,773 entries, and the number of bases reached 3,728,000,562.
- We introduced VERSION number (Nucleotide ID and Protein ID) into operation from release 37. According to this, use of NID and PID were terminated from release 39.
New prefix of accession number, AX and AY were added from this release.
AX will be used by EMBL for patent data, and AY for direct submission by GenBank.
NIG network service temporary down Nov. 2nd, 1999
- NIG (National Institute of Genetics) network service will be unavailable during the following dates because of the electric power cut.
We appreciate your cooperation.
- Nov. 12 (Fri) 17:00 - 13 (Sat) 21:00
- * supernig will be unavailable from Nov. 12 (Fri) 12:00 to 13 (Sat) 21:00.
SAKURA server temporary down Oct. 15
, 1999
- A part of the SAKURA service will be down temporarily because of the SAKURA
server upgrading, as follows.
We appreciate your cooperation.
- Affected service: SAKURA, TxSearch, Mass submission template constructing sy
stem
- Date: Wed., Oct. 20, 9:00-13:00
supernig periodic maintenance Oct. 7
, 1999
- Supernig service will be unavailable during the following date because of th
e periodic maintenance.
We appreciate your cooperation.
- Oct. 15 (Fri) 12:00 - 21:00
Elimination of EMBL, EMBLNEW and GBNEW f
rom supernig and VPP500 Oct. 5th, 1999
- EMBL, EMBLNEW and GBNEW databases were dropped from NIG mainframe computers
(supernig and VPP500) as of October 1st, 1999.
Now you can use only DDBJ and DDBJNEW on supernig and VPP500.
It should be noted that the DDBJ/EMBL/GenBank International Nucleotide Sequence
Database shares the same data.
Difference among DDBJ, EMBL and GenBank databases are only their formats.
Elimination of NID and PID from DDBJ dat
abase Oct. 1st, 1999
- DDBJ/EMBL/GenBank International Nucleotide Sequence Database decided to intr
oduce sequence version number
(version line for nucleotide sequences and /protein_id for amino acid sequences)
at the collaborators meeting held at Mishima this year.
Because of this change, DDBJ will eliminate NID and PID, which are currently inc
luded in the DDBJ database entries, starting DDBJ release 39 (Oct. 1999).
Before that release, entries which will be open after September 30 will no longe
r have NID nor PID.
PID and NID will be eliminated from all the entries after distribution of DDBJ r
elease 39.
SINET (Internet connection between NIG a
nd outside) temporary down Sep. 30, 1999
- Some NIG network service will be down temporarily because of the SINET upgra
ding, as follows. It may take some time to recover the whole system.
We appreciate your cooperation.
- Date: Friday, October 1, 12:00 - 14:00
- Affected service: Internet connection between NIG and outside
DDBJ Released 7.3 Mb of Human Genome Data Sep. 21, 1999
- DDBJ released human genome data submitted by the Sakaki (RIKEN/Univ. of Tokyo) and the Shimizu (Keio Univ) teams as of September 13.
- This time the Sakaki team submitted data of 60 clones from chromosomes 11 and 21 (AP000431-AP000490) and the Shimizu team submitted those of 7 clones from chromosome 8 (AP000424-AP000430).
The total number of bases for the 67 clones together is about 7.3 Mb.
This means that the Japanese Human Genome Groups have submitted and released through DDBJ about 25.3 Mb in total in the past year.
supernig periodic maintenance Sep. 10, 1999
- Supernig service will be unavailable during the following date because of the periodic maintenance.
- Sep. 17 (Fri) 12:00 - 21:00
DAD Rel.8, was released Sep. 6, 1999
- DDBJ amino acid database (DAD) Release 8 was released on Aug. 30, 1999 at DDBJ.
DAD Release 8 consists of 419,30 entries, and the total number of residues reached 128,581,164.
supernig periodic maintenance Aug. 19, 1999
- Supernig service will be unavailable during the following date because of the periodic maintenance.
- August 27 (Fri) 12:00 - 21:00
EMBL Release 59 was released Aug. 10, 1999
- EMBL Release 59 was released on line to the public on Aug. 10, 1999 at DDBJ.
EMBL Release 59 consists of 3,952,878 entries, and the total number of bases reached 2,924,568,545.
PIR Release 61 was released Aug. 17, 1999
- PIR amino acid database Release 61 was released on line to the public on Aug. 10, 1999 at DDBJ.
PIR Release 61 consists of 130,886 entries, and the total number of residues reached 43,065,574.
fixing Y2K preblem on supernig Aug. 5, 1999
- Supernig service will be unavailable during the following dates due to fix Y2K preblem.
- August 11 (Wed) 10:00 - 13 (Fri) 18:00
DDBJ Rel. 38 Completed Aug. 2, 1999
- The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media.
We completed DDBJ Release 38 in July 30, 1999. DDBJ Release 38 consists of 4,294,369 entries, and the number of bases reached 3,098,519,597.
Proportions of entries collected in Japan, U. S. A. and Europe are 11%, 81.8% and 7.9%.
On the last release, the number of entries collected in Japan exceeded European ones for the first time. At this release 38, the difference increased.
- We had put new system VERSION number (Nucleotide ID and Protein ID) into operation from release 37. According to this, NID and PID will be terminated on release 39 (October 1999) .
- Please see DDBJ statitics for more information
28,000 nematode ESTs have been made public Aug. 2, 1999
- Sequences of C. elegans ESTs 28,278 entries have been submitted to DDBJ by Dr. Y. Kohara at Genetic Resources Laboratory, Center for Genetic Resource Information, the National Institute of Genetics.
We assigned accession numbers AV175735-AV204012 to these sequences, and released them in the EST division of the DDBJ/EMBL/GenBank International Nucleotide Sequence Database.
Pyrococcus abyssi was added to GIB Jul. 28, 1999
- GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequence data of Pyrococcus abyssi were released, we incorporated them to GIB, and now you can search those data.
supernig periodic maintenance Jul. 15, 1999
- It happens in the following date, and be lets the service of supernig be suspended for the periodic maintenance of supernig.
- Jul. 23 (Fri.) 12:00 - 21:00
A modification to the homology search service Jul. 14, 1999
- We increased the number of target division on the DDBJ FASTA/BLAST/SSEARCH homology search system.
When you specify [DDBJ release] as the target database, you can select target divisions from list box.
In EST division, 6 target divisions were available.
We added 25 EST divisions to this list.
Now you can use 31 EST divisions which are from top 30 organisms and others.
Multiple selection is also available.
- List of new target division:
- Drosophila melanogaster, Rattus norvegicus, Saccharomyces cerevisiae,
Rattus sp. , Schizosaccharomyces pombe, Plasmodium falciparum, Danio rerio,
Dictyostelium discoideum, Brugia malayi,
Magnaporthe grisea, Emericella nidulans, Neurospora crassa, Bombyx mori, Zea may
s, Toxoplasma gondii, Xenopus laevis, Oryctolagus cuniculus, Trypanosoma cruzi,
Sus scrofa, Onchocerca volvulus, Glycine max, Schistosoma mansoni, Lycopersicon
esculentum, Leishmania major, Cryptosporidium parvum
175,000 mouse ESTs have been made public Jun. 28, 1999
- Sequences of Mus musculus cDNA have been submitted to DDBJ by
Dr. Y. Hayashizaki (Project Leader)'s team at the RIKEN
(Institute of Physical and Chemical Research) Genomic Sciences Center.
We assigned accession numbers AV000001-AV175734 to these sequences,
and released them in the EST division of the DDBJ/EMBL/GenBank International Nucleotide Sequence Database.
Aeropyrum pernix was added to GIB Jun. 28, 1999
- GIB (Genome Information Broker for Microbial Genomes)
provides a comprehensive view of the complete microbial genome sequences.
Because the complete genome sequence data of Aeropyrum pernix were released by DDBJ, we incorporated them to GIB, and now you can search those data.
Accession numbers of those data are AP000058-AP000064.
Thermotoga maritima was added to GIB Jun. 10, 1999
- GIB
(Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the complete genome sequence data of Thermotoga maritima were rel
eased, we incorporated them to GIB, and now you can search those data.
SAKURA Version 2.24 released Jun. 10, 1999
- SAKURA Version 2.24 was released on June 8.
- - Feature information (CDS feature, Other Features and Qualifiers) was changed to mandatory. If there is no information on feature fields, you will receive an error message.
- - Related to the change of feature information treatment,
explanation was added on the Japanese top page.
Construction and background were also changed.
- - Recently, the number of authors on [Primary Citation] field are increasing. So, we changed maximum number of authors from 10 to 20 on [Primary Citation] field.
supernig periodic maintenance Jun. 10, 1999
- It happens in the following date, and be lets the service of supernig be suspended for the periodic maintenance of supernig.
- Jun. 18 (Fri.) 12:00 - 21:00
PDB Rel. 87 was released Jun. 4, 1999
- PDB rel. 87 was released on line to the public on Jun. 2, 1999 at DDBJ.
PDB rel. 87 consists of 9,179 entries.
get-version released Jun. 2, 1999
- DDBJ introduced a new system to identify for both nucleotide and protein sequences with version numbers (Nucleotide ID and Protein ID) since DDBJ rel. 37 (Mar. 1999).
Therefore DDBJ released "get-version" system which is able to search these version numbers.
To use this system, send an e-mail message containing the formatted query ACCESSION and VERSION NUMBER to the following e-mail address
"get-version@nig.ac.jp".
If you need help message, please send e-mail to get-version@nig.ac.jp with the word "help-e" in the mail body.
supernig periodic maintenance May 21, 1999
- It happens in the following date, and be lets the service of supernig be suspended for the periodic maintenance of supernig.
- May 26 (Wed) 9:00 - 28 (Fri) 21:00
CAUTION ! May 19, 1999
- We at DDBJ will stop our service of receiving DNA sequence data by SAKURA,
issuing accession numbers and updating submitted data during the following period, because of grading up our server machines.
Thanks for your understanding and cooperation.
- From : 1999.5.21 (Fri) 8:30 a.m.
- To : 1999.5.24 (Mon) 10:00 a.m.
International Nucleotide Sequence Database Collaborative and Advisory Meetings May 18, 1999
- The International Nucleotide Sequence Databanks, CIB/DDBJ, EBI/EMBL,
and NCBI/GenBank, hold the Collaborative Meeting once a year and the Advisory Meeting every other year in order to scheme operation and continuation of the
construction of the DNA database international collaboration.
- The host of this year was DDBJ, and the meetings were held in Mishima:
the International Collaborative Meeting from April 19 to 21; the International Advisory Meeting from April 22 to 23.
The attendance from U.S.A. was six, from Europe was eleven.
13 Mbases of human chromosome 21 have been made public (ACC#AP000084 - ACC#AP000219) May 17, 1999
- Sequences of three regions of human chromosome 21, 21q21.1, 21q22.1,
21q22.3-ter, have been submitted to DDBJ by Dr. Y. Sakaki's team of the Institute of Physical and Chemical Research (RIKEN).
- We assigned accession numbers, AP000136-AP000219, to these sequences, and released to public as HTG Division in DDBJ/EMBL/GenBank International Nucleotide Sequence Database.
Prior to the present release, we already publicized another set of sequences of human chromosome 21 (21q22.1) with accession numbers AP000084-AP000135 which were submitted by the Japan Science Technology Corporati on (JST).
- In total we have made public about 13 Mbases of human genome sequence data.
- Links to these entries
supernig periodic maintenance Apr.
16, 1999
- It happens in the following date, and be lets the service of supernig be sus
pended for the periodic maintenance of supernig.
- Apr. 23 (Fri) 12:00 - 21:00
EMBL Release 58 was released Apr. 1
6, 1999
- EMBL Release 58 was released on line to the public on Apr. 15, 1999 at DDBJ
. EMBL Release 58 consists of 3,272,064 entries, and the total number of bases
reached 2,355,200,790.
DDBJ Rel. 37 Completed Apr. 5, 1999
- The nucleotide sequence database collected and maintained by DDBJ is quarter
ly released on line to the public and distributed in the magnetic media.
We completed DDBJ Release 37 in Mar. 26, 1999. DDBJ Release 37 consists of 3,311
,627 entries,
and the number of bases reached 2,375,261,951.
- Since the content of a nucleotide sequence is often revised due to replaceme
nts,
additions and deletions of bases made by the submitter,
the accession number sometimes does not work to tell which sequence is really in
question.
Thus, an additional identifier was introduced to specify a particular sequence i
n a series of revised sequences.
This identifier is called NID.
For the same reason for translated amino acid sequences, PID was brought into be
ing.
NIG DNA database advisory committee
Apr. 5, 1999
- DNA Database Advisory Committee is held annually at the National Institute o
f Genetics for the purpose of recommendation about DNA database activity plans s
uch as data construction, software development, and service. This year, the meet
ing was held on March 25.
New homology search service Mar. 17
, 1999
- DDBJ added new functions to homology search syshtmltem in DDBJ WWW site.
- 1. DAD and SWISS-PROT databases include new data. DAD is updated everyday,
and SWISS-PROT is every Friday.
- 2.You can receive results by e-mail in HTML format, and can load them into
a web browser for viewing.
- To use this function in web site:
When you select E-Mail at RESULT, please use check box of [In HTML format].
- To use this function using e-mail server:
Please add a new line "html 1" in your request.
ex.) program blastn
datalib ddbj
scores 100
alignments 100
expect 10
gap 1
filter 1
html 1 <-- add this line
begin
> query
aaacccgggtttaaaaaaaacggttttt
...........
//
LIBRA I updates Mar. 16, 1999
- LIBLA I is a computer application for analyzing protein structures and seque
ndes.
Inverse folding search (Compatible Sequence Search with a query structure)
by LIBRA I has
been available.
supernig periodic maintenance Mar.
11, 1999
- It happens in the following date, and be lets the service of supernig be
suspended for the periodic maintenance of supernig.
- Mar. 19 (Fri) 12:00 - 21:00
SAKURA V2.23 released Mar. 3rd, 199
9
- SAKURA V2.23 was released on March 3rd. SAKURA V2.23 is updated version of S
AKURA V2.22, and added a new function of adding /focus qualifier automatically.
GenBank terminated to accept Authorin submission Feb. 17, 1999
- GenBank has been phasing out use of Authorin as a data submission
tool. We DDBJ still accept Authorin submissions. However, we terminated
distribution, because Authorin is not compatible with Macintosh 32bit
addressing nor Windows.
- We DDBJ recommend you to use
SAKURA on the Web or
sequin ver. 2.6,
a stand-alone program for PC, Macintosh, and Unix platforms.
PIR Release 59 was released Feb. 17, 1999
- PIR amino acid database Release 59 was released on line to the
public on Feb. 17, 1999 at DDBJ. PIR Release 59 consists of 117,704
entries, and the total number of residues reached 37,890,243.
supernig periodic maintenance Feb.17, 1999
- It happens in the following date, and be lets the service of
supernig be sus pended for the periodic maintenance of supernig.
- Feb. 26 (Fri) 12:00 - 21:00
C. elegans genome data are appended to DDBJ homology search service Feb. 5, 1999
- C. elegans genome data (DNA and Protein) were appended for
DDBJ homology search service
(
FASTA/BLAST/PSI-BLAST/SSEARCH).
- "C. elegans[wormpep](protein)" and "C. elegans (DNA)" are
available as a target database.
- When "C. elegans[wormpep](protein)" was specified, there is
a dynamic link to the wormace at Sanger Centre from the result.
It is available through the DDBJ WWW server and DDBJ E-mail server.
- Information about comment of DNA data are below.
- chromosome number/ start-end, source, feature, [group]
- These are from GFF format(http://www.sanger.ac.uk/Users/rd/gff.shtml).
- start, end
- Integers. "start" must be less than or equal to "end".
Sequence numbering starts at 1, so these numbers should be
between 1 and the length of the relevant sequence, inclusive.
- source
- The source of this feature. This field will normally be used
to indicate the program making the prediction,
or if it comes from public database annotation,
or is experimentally verified, etc.
- feature
- The feature type name. We hope to suggest a standard set of
features, to facilitate import/export, comparison etc.. Of course,
people are free to define new ones as needed.
- For example, Genie splice detectors account for a region of
DNA, and multiple detectors may be available for the same site,
as shown above.
- [group]
- An optional string-valued field that can be used as a name
to group together a set of records. Typical uses might be to group
the introns and exons in one gene prediction (or experimentally
verified gene structure),
or to group multiple regions of match to another sequence,
such as an EST or a protein.
Continuation of the GDB project Jan. 26, 1999
- It has been decided that the Genome Database (GDB) project,
whose termination was announced on this site (Oct. 13, 1998),
will continue its activities.
While data curation will continue at The Johns Hopkins University
School of Medicine in Baltimore (JHU), replication of data to
the international nodes will occur from a central editable node at the
Bioinformatics Centre at the Hospital for Sick Children (HSC) in Toronto,
Canada (
http://bioinfo.sickkids.on.ca/gdb/temp.html).
Transfer of the primary node to HSC will take place by early 1999.
Please see http://gdbwww.gdb.org/
for more information.
DDBJ Rel. 36 Completed Jan. 18, 1999
- The nucleotide sequence database collected and maintained by DDBJ is
quarterly released on line to the public and distributed in the magnetic media.
- We completed DDBJ Release 36 in Jan. 14, 1998.
DDBJ Release 36 consists of 3,073,166 entries,
and the number of bases reached 2,190,425,560.
supernig periodic maintenance Jan. 18, 1999
- It happens in the following date, and be lets the service of
supernig be suspended for the periodic maintenance of supernig.
- Jan. 22 (Fri) 12:00 - 21:00
SRS is now available in DDBJ WWW site Jan. 18, 1999
- SRS
is the sequence retrieval system developed by EBI.
DDBJ modified it for DDBJ databases and made available this system.
- Target database
- - sequence database : DDBJ, DDBJNEW, DAD, SWISSPROT, PIR
- - sequence-related database: PROSITE, PROSITEDOC, ENZYME
- - protein tertiary structure database: PDB
- The URL is http://ftp2.ddbj.nig.ac.jp:8000/srs/ .
This has a link from [Database Searches and Data Analyses] of DDBJ Home Page.
|