Last updated:2014.10.2.

What’s New(2001)

NIG network service temporary down Dec. 21, 2001
NIG (National Institute of Genetics) network service will be unavailable during the following dates because of the network maintenance.
Thank you for your understanding and cooperation.
Dec. 27 (Thu) 15:00 - 28 (Fri) 9:00
Extended version of CLUSTALW by DDBJ was released Dec. 20, 2001
CLUSTALW is the program for multiple alignment and tree-making. DDBJ released an extended version of CLUSTALW on Dec. 7, 2001. The extended options are as follows:
- When you specify ALIGN "on" for multiple alignments, dot option is available. In this description, identical part of the sequences are indicated as dot (see example).
- When you specify TREE "on" to reconstruct a phylogenetic tree from nucleotide sequences, as a method for estimation of a genetic distance, Tamura, Tajima-Nei, Gojobori-Ishii-Nei 6-parameter and Tamura-Nei as well as Jukes-Cantor and Kimura 2-parameter, can be selected.

example : 
CLUSTAL W (1.81) multiple sequence alignment 
A1-1_A101      GGCCGACCCTTCGGCCCGGGGGCC
A1-2_A102      ......T.................
A1-3_A103      NNNN..T.T...............
A1-4_A104      NNNN.G..................
A2             NNNN..T................-
AX             NNNN......A.............
A3-1           NNNN................A...
cis-AB         NNNN..T...........C.....
O-1_O101       ....-...................
O-2_O201       TATT-G....A.A..T...A....
O-3            NNNN.G.G.........A......
O-4_O102       NNNN-....C..............
O-5_O103       NNNN-G..................
O-6_O202       NNNN-.....A.A..T...A....
O-7_O203       NNNN-G....A.A.TT...A....
B-1_B101       .....G.G...T.A..A.C..A..
B-2_B102       NNNN.G.G...T.A..A.C.....
B-3_B103       NNNN.G.G.....A..A.C..A..
B(A)           NNNN.G.G........A.C..A..
B3-1           NNNN.G.G...T.A..A.C..AT.
               ************************
Updates of "Conference on information biology" Dec.19, 2001
Evolution 2002 (June 28-July 2, 2002) and Bio China 2002 (August 28-31, 2002) were added to "Conference on information biology".
Agrobacterium tumefaciens C58 (Dupont) was added to GIB Dec. 18, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequence data of Agrobacterium tumefaciens C58 (Dupont) was released, we incorporated it to GIB, and now you can search those data.
Institute: University of Washington
Reference: The Genome of the Natural Genetic Engineer Agrobacterium tumefaciens C58, Science 294 (5550), 2317-2323 (2001)
Ralstonia solanacearum GMI1000 was added to GIB Dec. 12, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequence data of Ralstonia solanacearum GMI1000 was released, we incorporated it to GIB, and now you can search
those data.
Institute: Genoscope and CNRS UMR-8030
Reference: Genome sequence of the plant pathogen Ralstonia solanacearum, Unpublished
Version-up of TXSearch Dec. 11, 2001
TXsearch is a retrieval system for a Taxonomy Database unified by DDBJ, GenBank and EMBL. DDBJ released TXSearch Version 2.0 on Dec. 7, 2001. The main purpose of this version-up was to accommodate the system to RDB. Although no function was newly added, the maximum number of retrieval results was changed from 1000 to infinity.
Suspension of the DDBJ activity during the New Year Holidays Dec. 7, 2001
We at DDBJ will suspend our business during the New Year Holidays from December 29th, 2001 to January 3rd, 2002. We will stop most activities including receiving data and issuing
accession numbers during that period, and resume the normal business on January 4th, 2002.
Please note in particular that SAKURA will stop in operation from December 26th, 2001 to January 3rd, 2002.
Thank you very much for your understanding and cooperation.
We wish you a Merry Christmas and Happy New year.
DNA Data Bank of Japan
PIR rel. 70 was released Dec. 6, 2001
PIR Rel. 70 was released on Dec. 6, 2001 at DDBJ. PIR Rel. 70 consists of 250,417 entries, and the total number of residues reached 85,931,133 aa.
Nostoc sp. PCC 7120 was added to GIB Dec. 5th, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Nostoc sp. PCC 7120 was released, we incorporated it to GIB, and now you can search those data.
Institute: Kazusa DNA Research Institute
Reference: Complete Genomic Sequence of the Filamentous Nitrogen-fixing Cyanobacterium Anabaena sp. strain PCC 7120, DNA Res. 8, 205-213 (2001)
PRF Rel. 82 was released Dec. 5th, 2001
PRF (Protein Research Foundation)/SEQ database Release 82 was released on Dec. 4, 2001 at DDBJ. PRF Release 82 consists of 184,903 entries, and the total number of residues reached 66,779,128.
NIG network service temporary down Nov. 29, 2001
NIG (National Institute of Genetics) network service will be unavailable during the following date because of the network maintenance.Thank you for your understanding and cooperation.
Dec. 1st (Sat) 13:00 - 21:00
Recovery of the DDBJ web pages Nov. 27, 2001
Due to an accident of the server maintenance, some pages could not be accessed from Nov. 17 to 26. They are recovered now.
We apologize for the inconvenience and thank you for your understanding.
DAD rel. 17 was released Nov. 27, 2001
DDBJ amino acid database (DAD) Release 17 was released on Nov. 19, 2001 at DDBJ. DAD Release 17 consists of 863,193 entries, and the total number of residues reached 265,285,159.
SWISS-PROT Rel. 40 was released Nov. 27, 2001
SWISS-PROT Rel. 40 was released on Nov. 19, 2001 at DDBJ. SWISS-PROT Rel. 40 consists of 101,602 entries, and the total number of residues reached 37,315,215.
Reopen the DDBJ release in XML (DDBJ-XML V.1.1) Nov. 14, 2001
DDBJ reopened the whole release retrieve service in XML format.
XML formatted files of DDBJ release 47 (Dec. 2001) can be retrieved through the following anonymous FTP:
ftp://ftp.ddbj.nig.ac.jp/ddbj_database/ddbj/xml/
DDBJ started to provide unified daily update data (NEW data) in XML format.
Newly-arrived/updated entries after the last release are now available through the following anonymous FTP:
ftp://ftp.ddbj.nig.ac.jp/ddbj_database/ddbjnew/xml/
NIG network service temporary down Nov. 8, 2001
NIG (National Institute of Genetics) network service will be unavailable during the following dates because of the electric power cut. We appreciate your cooperation.
Nov. 16 (Fri) 17:00 - 18 (Sun) 9:00
Listeria innocua Clip11262 and Listeria monocytogenes EGD-e were added to GIB Nov. 1st, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequence data of Listeria innocua Clip11262 and Listeria monocytogenes EGD-e were released, we incorporated them to GIB, and now you can search those data.

Institute: Institut Pasteur
Reference:Comparative genomics of Listeria species, Science 294, 849-852 (2001)
>Salmonella typhi CT18 was added to GIB Oct. 31, 2001
GIB (Genome Information Broker forMicrobial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequence data of Salmonella typhi CT18 was released, we incorporated it to GIB, and now you can search those data.

Reference:
Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18, Nature 413, 848-852 (2001)
Updates of "Conference on information biology" Oct. 29, 2001
HGM 2002 (April 14-17, 2002) and 4th HUGO Pacific Meeting and 5th Asia-Pacific Conference on Human Genetics (October 27-30, 2002) were added to "Conference on information biology".
Salmonella typhimurium LT2 was added to GIB Oct. 29, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the following genome sequence data of Salmonella typhimurium LT2was released, we incorporated it to GIB, and now you can search those data.

Reference:
The complete genome sequence of Salmonella enterica serovar Typhimurium LT2:features revealed by comparison to related genomes, Nature 413, 852-856 (2001)
PRF/SEQ database was added to DDBJ search services as a target database Oct. 25, 2001
DDBJ added PRF (Protein Research Foundation)/SEQ database to DDBJ search services (fasta, blast, psi-blast, ssearch and getentry) as a target database. PRF/SEQ database Rel. 81 is available now. Rel. 81 consists of 177,941 entries, and the total number of residues is 64,250,763 aa.
* PRF/SEQ database consists of amino acid sequences of peptides and proteins, including sequences deduced from genes collected by Protein Research Foundation.
Updates of "Conference on information biology" Oct. 23, 2001
THE SIX SHIZUOKA FORUM ON HEALTH AND LONGEVITY(November 9-10, 2001) was added to "Conference on information biology".
Updates of "Conference on information biololgy" Oct. 22, 2001
BGRS'2002(July 14-20, 2002) was added to "Conference on information biology".
Yersina pestis CO92 was added to GIB Oct. 16, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequence data of Yersina pestis CO92 was released, we incorporated it to GIB, and now you can search those data.

Reference:
Genome sequence of Yersinia pestis, the causative agent of plague, Nature 413, 523-527(2001)
DDBJ Rel. 47 Completed Oct. 16, 2001
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media. We completed DDBJ Release 47 in Oct. 2001. DDBJ Release 47 consists of 13,266,610 entries, and the number of bases reached 14,145,671,645.
supernig periodic maintenance Oct. 12, 2001
Supernig service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Oct. 19, 2001 (Fri) 12:00-21:00
Updates of "Conference on information biology" Oct. 11, 2001
Bioinformatics 2002 (February 6-8, 2002) was added to "Conference on information biology".
Version-up of GIB Oct. 1st, 2001
We enhanced GIB to version 3.0 to accommodate rapidly increasing genomic information. GIB 3.0 uses distributed RDBs on multiple PC-Linux platforms and a homology search server on Unix platform. The WWW server communicates with these servers by use of
CORBA and XML. The new version of GIB stores, processes and displays all the features in the Flat Files including CDS and RNA. In a comparative genomes page of GIB 3.0, you can select multiple genomes that you are interested in. The user interface is improved in GIB 3.0 as well.
Streptococcus pneumoniae R6,Rickettsia conorii and Sulfolobus tokodaii were added to GIB Sep. 18, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the following genome sequencedata were released, we incorporated them to GIB, and now you can search those data.
Streptococcus pneumoniae R6

Institute: Eli Lilly and Company: Genome of the Bacterium
Reference: Streptococcus pneumoniae Strain R6, J. Bacteriol. 183 (19),5709-5717 (2001)

Rickettsia conorii

Institute: Genoscope, Universite de la Mediterranee
Reference: Mechanisms of Evolution in Rickettsia conorii and Rickettsia prowazekii, Science 293, 2093-2098 (2001)

Sulfolobus tokodaii

Institute: National Institute of Technology and Evaluation
Reference: Complete genome sequence of an Aerobic Thermoacidophilic Crenarchaeon, Sulfolobus tokodaii strain7. DNA Res.(2001) In press
Minerva periodic maintenance Sep. 14, 2001
Minerva service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Sep. 21, 2001 (Fri) 10:00 a. m. - 22:00 p. m.
Temporary stop of the XML format distribution Sep. 12, 2001
DDBJ stopped data distribution in XML format temporary because of a system trouble. It will recover in a week.
Thank you very much for your understanding and cooperation.
ERROR occurred in the HOMOLOGY SEARCH !!! Aug. 24, 2001
We apologize to those who used:
- either FASTA or BLAST
- by sending query and getting results via the WWW interface (*)
- during July 17th and August 23rd
- to search the database "DDBJ all data (DNA)" and the division of "Invertebrate", "Plant" or "Bacteria"
The system returned you wrong results.
We express regret for your inconvenience caused by the error.
(*) The information is valid, if you get results via E-mail.
If you sent a query by E-mail and get the result by E-mail, you have valid results.
Agrobacterium tumefaciens was added to GIB Aug. 17, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of Agrobacterium tumefaciens was released, we incorporated it to GIB, and now you can search those data.
Reference: Complete Genome Sequence of Agrobacterium tumefaciens C58 (Rhizobium radiobacter C58), the Causative Agent of Crown Gall Disease in Plants, Unpublishe
Shinorhizobium meliloti was added to GIB Aug. 10, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of Shinorhizobium meliloti was released, we incorporated it to GIB, and now you can search those data.
Reference:
Analysis of the chromosome sequence of the legume symbiont Sinorhizobium meliloti, Unpublished
PIR rel. 69 was released Aug. 9, 2001
PIR Rel. 69 was released on Aug. 9, 2001 at DDBJ. PIR Rel.69 consists of 232,624 entries, and the total number of residues reached 80,607,033 aa.
Arbidopsis thaliana was added to GIB Aug. 7, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
GIB is now not only for microbes but also Arbidopsis thaliana. The genome sequence of Arabidopsis thaliana is retirievable in the Genome Information Broker (GIB)
DAD rel. 16 was released Aug. 3rd, 2001
DDBJ amino acid database (DAD) Release 16 was released on Aug. 3rd, 2001 at DDBJ. DAD Release 16 consists of 797,764 entries, and the total number of residues reached 245,236,540.
Clostidium acetobutylicum was added to GIB Jul. 31, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Clostidium acetobutylicum was released, we incorporated it to GIB, and now you can search those data.
Reference:
Genome Sequence and Comparative Analysis of the Solvent-Producing BacteriumClostridium acetobutylicum, J. Bacteriol. 183 (16), 4823-4838 (2001)
The DDBJ release is now available also in XML Jul. 25, 2001
DDBJ now applied XML not only to entry by entry but also to the whole release in July 2001. XML formatted files of DDBJ release 46 (July 2001) can be retrieved through the following anonymous FTP:
ftp://ftp.ddbj.nig.ac.jp/ddbj_database/ddbj/xml/
DDBJ Release in XML
Copyright 2001 National Institute of Genetics, Center for
Information Biology and DNA Data Bank of Japan. No reproduction or republication in any form without written permission.

Reference:
Miyazaki S and Sugawara H, "Development of DDBJ-XML and its application to a database of cDNA" , Genome Informatics 2000, Universal Academy Press, Inc (Tokyo), 380-381, 2000
Miyazaki S and Sugawara H, "Visualization of features in flat file by use of DDBJ-XML", Currents in Computational Molecular Biology 2001 (Montreal), 249-250, 2001
Streptococcus pneumoniae was added to GIB Jul. 25, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Streptococcus pneumoniae was released, we incorporated it to GIB, and now you can search those data.
Reference: Complete Genome Sequence of a virulent isolate of
Streptococcus pneumoniae, Science 293 (5529), 498-506 (2001)
Updates of "Conference on information biology" July 25, 2001
The Fourth International Workshop on Advanced Genomics From Genomics to Proteomics (November 13-14, 2001) was added to "Conference on information biology".
DDBJ Rel. 46 Completed Jul. 17, 2001
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media. We completed DDBJ Release 46 in Jul. 2001.
DDBJ Release 46 consists of 12,313,759 entries, and the number of bases reached 13,037,646,166.
"DDBJ/CIB Human Genomics Studio" service reopening Jul. 16, 2001
We reopened "DDBJ/CIB Human Genomics Studio" service.We appreciate your cooperation.
Minerva periodic maintenance Jun. 14, 2001
Minerva service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Jun. 22, 2001 (Fri) 12:00-21:00
supernig periodic maintenance Jun. 14, 2001
Supernig service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Jun. 22, 2001 (Fri) 16:00-21:00
Thermoplasma volcanium was added to GIB Jun. 7, 2001
GIB (Genome Information Broker for Microbial Genomes)
provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Thermoplasma volcanium was released, we incorporated it to GIB, and now you can search those data.
Reference: Determination of the complete genomic DNA sequence
of Thermoplasma volcanium, Proc. Natl. Acad. Sci. U.S.A. 97, 14257-14262 (2000)
Mesorhizobium loti was added to GIB May 31, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Mesorhizobium loti was released, we incorporated it to GIB, and now you can search those data.
Reference: Complete genome structure of the nitrogen-fixing symbiotic bacterium Mesorhizobium loti., DNA Res. 7, 331-338 (2000)
Updates of "Conference on information biology" May.25, 2001
The 2001 Annual Meeting of the CBI Society (July 25-27, 2001), The 8th International Congress on Endocytobiology and Symbiosis (October 12-17, 2001) and Evolutionary Genomics - New Paradigm of Biology in the 21st Century (November 4-6, 2001) were added to "Conference on information biology".
Updates of "Conference on information biology" May 24, 2001
Artificial Intelligence and Heuristic Methods for Bioinformatics (October 1-11, 2001) was added to "Conference on information biology".
Mycoplasma pulmonis was added to GIB May 22, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Mycoplasma pulmonis was released, we incorporated it to GIB,and now you can search those data.
Reference: The complete genome sequence of the murine respiratory pathogen Mycoplasma pulmonis, Nucleic Acids Res. 29(10), 2145-2153(2001)
PIR rel. 68 was released May 21, 2001
PIR Rel. 68 was released on May 21, 2001 at DDBJ. PIR Rel.68 consists of 219,241 entries, and the total number of residues reached 76,174,552 aa.
Updates of "Conference on information biology" May.16, 2001
The Ribosome (May 31-June 5, 2001),
Mechanisms of Cell Death and Disease:Advances in Therapeutic Intervention (June 2-5, 2001) , Bioinformatics Tools for Comparative Genomics (June 11-15, 2001) andPharmaConference '01 (August 5-9, 2001) were added to "Conference on information biology".
Staphylococcus aureus Mu50,Sulfolobus solfataricus and Mycobacterium tuberculosis CDC1551 were added to GIB May. 14, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the following genome sequencedata were released, we incorporated them to GIB,and now you can search those data.
Staphylococcus aureus Mu50

Reference:
Whole genome sequencing of methicillin-resistant Staphylococcus aureus, the major hospital pathogen, Lancet 357, 1225-1240 (2001)
Institute:
University of Tsukuba College of Medical Technology and Nursing

Sulfolobus solfataricus

Reference:
Unpublished
Institute:
Copenhagen University

Mycobacterium tuberculosis CDC1551

Reference:
Whole genome comparison of Mycobacterium tuberculosis clinical and laboratory strains, Unpublished
Institute:
The Institute for Genomic Research
DDBJ introduced XML May 11, 2001
DDBJ introduced XML for the data dissemination and named it DDBJ-XML. XML format is firstly implemented into a DDBJ search program named "getentry".
You could choose XML format from a pull-down menu of "getentry".
You could also find a link to the DTD file when you get the result of "getentry".
Reference:
Miyazaki, S and Sugawara, H, "Development of DDBJ-XML and Its Application to a Database of cDNA" , Genome Informatics 2000, Universal Academy Press, Inc (Tokyo),380-381,2000
Satoru Miyazaki and Hideaki Sugawara,"Visualization of Features in Flat file by use of DDBJ-XML", Currents in computational molecular biology 2001(Montreal), 249-250, 2001
DAD Rel.15 was released Apr. 27, 2001
DDBJ amino acid database (DAD) Release 15 was released on Apr. 26th, 2001 at DDBJ. DAD Release 15 consists of 741,845 entries, and the total number of residues reached 228,137,184.
Staphylococcus aureus was added to GIB Apr. 26, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Staphylococcus aureus was released, we incorporated it to GIB,and now you can search those data.
Reference: Whole genome sequencing of meticillin-resistant Stapylococcus aureus, The Lancet 357, 1225-1240 (2001)
supernig periodic maintenance Apr. 23, 2001
suprenig service will be unavailable during the following date because of the periodic maintenance and upgrade of Operating system (Solaris8). In connection with Upgrade of Operating system, recompilation may be needed with a part of program.
Thank you very much for your understanding and cooperation.
9:00 a.m, Monday May 7 - 9:00 a.m, Thursday May 10
DDBJ Rel. 45 Completed Apr. 17, 2001
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media. We completed DDBJ Release 45 in Feb. 2001. DDBJ Release 45 consists of 11,434,113 entries, and the number of bases reached 12,207,092,905. From the present release, we include a new division, HTC (High Throughput cDNA).
Streptococcus pyogenes was added to GIB Apr. 16, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Streptococcus pyogeneswas released, we incorporated it to GIB,and now you can search
those data.
Reference: Complete genome sequence of an M1 strain of Streptococcus pyogenes., Proc. Natl. Acad. Sci. U.S.A. 98 (8), 4658-4663 (2001)
minerva (VPP5000) periodic maintenance Apr. 16, 2001
minerva (VPP5000) service will be unavailable during the following date because of the periodic maintenance. Thank you very much for your understanding and cooperation.
Apr. 20th, 2001 (Fri) 12:00-21:00
CIB renamed CIB/DDBJ Apr. 6, 2001

The Center for Information Biology (CIB) of the National Institute of Genetics (NIG) changed its name to "the Center for Information Biology and DNA Data Bank of Japan (CIB/DDBJ)" in April 2001. Since DDBJ began its operations in 1986, it had been regarded as a project of the DNA Research Center and then as a project of CIB. Now DDBJ is officially recognized as an organization of NIG, and continues its activities as ever.
Updates of "Conference on information biology" Apr. 4, 2001
Antisense 2001 (May 21-22, 2001), Beyond Genome 2001 (June 17-22, 2001) and 13th International Genome Sequencing and Analysis Conference
(October 25-28, 2001) were added to "Conference on information biology".
Caulobacter crescentus was added to GIB Mar. 27, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Caulobacter crescentus was released, we incorporated it to GIB,and now you can search those data.
Announcement of temporary shutdown of the DDBJ web home page Mar. 26, 2001
Web homepage of DDBJ will have temporary shutdown during the following date due to server maintenance.
You cannot access DDBJ web homepage (http://www.ddbj.nig.ac.jp/) during that period. Thank you very much for your understanding and cooperation.
March 29 (Thu), 2001 10:00am - 12:00
Updates of "Conference on information biology"Mar. 26, 2001
MICROARRAYS AND MICROCHIPS JAPAN (June 4-5, 2001) and
WABI 2001 (August 28-31, 2001)
were added to "Conference on information biology".
Mycobacterium leprae was added to GIB Mar. 5, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.Because the genome sequencedata of Mycobacterium leprae was released, we incorporated it to GIB,and now you can search those data.
Updates of "Conference on information biology" Feb. 20, 2001
SMBE 2001 ANNUAL MEETING (July 7-10, 2001) was added to "Conference on information biology".
Publication of human genome draft sequences Feb. 19, 2001
Article on human genome draft sequences was published in Nature, February 15 (vol. 409, pp. 860-921) by International Human Genome Sequencing Consortium. == details ==
Updates of "Conference on information biology" Feb. 14, 2001
Genome Japan (March 26-27, 2001) and Genome Informatics Workshop 2001 (December 18-19, 2001) were added to "Conference on information biology".
Pasteurella multocida and Lactococcus lactis were added to GIB Feb. 5, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Pasteurella multocida and Lactococcus lactis were released, we incorporated them to GIB,and now you can search those data.
DAD Rel.14 and PIR Rel.67 were released Feb. 13, 2001
DDBJ amino acid database (DAD) Release 14 and PIR Release 67 were released on Feb. 9th, 2001 at DDBJ.
DAD Release 14 consists of 662,374 entries, and the total number of residues reached 205,640,609.PIR Release 67 consists of 198,801 entries, and the total number of residues reached 68,722,935.
Updates of "Conference on information biology" Feb. 9, 2001
RECOMB Satellite Meeting on DNA Sequence Assembly (May 19-20, 2001), Fifth Annual Conference On Computational Genomics (November 29-December 1, 2001) and Pacific Symposium on Biocomputing 2002 (January 3-7, 2002) were added to "Conference on information biology".
19,168 full-length mouse cDNAs with function annotation have been made public Feb. 8, 2001
Sequences of Mus musculus cDNA (full-length, with annotation on their function) have been submitted to DDBJ by Dr. Y. Hayashizaki (Project Director)'s team at the RIKEN (Institute of Physical and Chemical Research) Genomic Sciences Center. We assigned accession numbers AK002213-AK018700 (16,454 entries), AK018701-AK021412 (2,712 entries) , AK027261-AK027262 (2 entries) to these sequences, and released them in the HTC division of the DDBJ/EMBL/GenBank International Nucleotide Sequence Database.The sequences were also published in Nature 409, 685-690 (8/2/2001).
E.coli O157:H7 was added to GIB Feb. 5, 2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of E.coli O157:H7 was released, we incorporated it to GIB,and now you can search those data.
Renewal of DDBJ WWW Home Page Feb. 1, 2001
We started web home page of DDBJ in December 1994, and this web server include many services such as "Data Submission" and"Database Search and Analysis".
We renewed our home page in the end of January. The basic color is navy blue and headlines were divided into two. There are link buttons to major items in the left side. Key word search, site map, and jump button are also available in this new system. The URL is
[http://www.ddbj.nig.ac.jp/]. (not changed) ["Other Databases moved to "Links to information biology databases".]
DDBJ Rel. 44 Completed Jan. 31, 2001
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media. We completed DDBJ Release 44 in Jan. 2001.
DDBJ Release 44 consists of 10,165,597 entries, and the number of bases reached 11,136,298,841.
Updates of "Conference on information biology" Jan. 31, 2001
The 6th International Symposium on Genome Science in the 21st Century (March 14-17, 2001) was added to "Conference on information biology".
LIBRA I updates Jan. 30, 2001
A computer application of threading:
LIBRA I was improved. Structural library of LIBRA was enlarged to about 3,000 structures
Supernig system shutdown due to hardware replacement Jan. 30, 2001
We at NIG are going to replace the computer system VPP500 with VPP5000 in order to catch up with the steep increase in the DNA data and the various needs of research today. We are also going to introduce a new server (PrimePower M2000).
Accordingly, we will stop the supernig system as follows.
We appreciate your understanding and cooperation.

-  The system (front end processor) is scheduled to be shutdown from Feb. 12 to Feb. 15.
¡¡ The new system is scheduled to start on Friday, Feb. 16.¡ÊDetail¡Ë
-  The system (back end processor) is scheduled to be shutdown from Feb. 12 to Feb. 25.
¡¡The new system is scheduled to start on Feb. 26 (Mon.).¡ÊDetail¡Ë

Announcement of temporary shutdown of the DDBJ web home page Jan. 26, 2001
Web home page of DDBJ will have temporary shutdown due to its server exchange.
Scheduled shutdown time is 15:00 - 16:00, Monday, January 29.
You cannot access DDBJ web homepage ( http://www.ddbj.nig.ac.jp/) during that time period. This sever change is coupled with major change of web home page.
Thank you for your understanding and cooperation.
Updates of "Conference on information biology" Jan.26, 2001
GEMINI - Genes and Minds Initiative: Workshop on Ape Genomics (March 14-15, 2001) was added to "Conference on information biology".
DDBJ will stop accepting submissions by 'Authorin' and 'Submission Form' Jan. 25, 2001
DDBJ is now developing a new data management system to cope more efficiently with a large amount of incoming data. The new data management system is expected to be in operation from April 1st, 2001.
Since the new system no longer accommodates data presented in 'Authorin' or 'Submission Form', DDBJ will stop accepting data in those two forms from April 1st, 2001.
Please use the WWW submission tool, SAKURA instead of the two forms.
Thank you very much for your understanding and cooperation.
Supernig periodic maintenance Jan. 12, 2001
Supernig service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Jan. 19, 2001 (Fri) 12:00 - 21:00
Updates of "Conference on information biology" Jan. 10, 2001
5th evolutionary biology meeting (June 27-29, 2001) was added to "Conference on information biology".
ページの先頭へ戻る