 |
 |
 |
|
|
 |
|
|
 |
 |
|
|
|
 |
|
Contact Us
|
Copyright © 1995-2006
DDBJ All rights reserved. |
|
 NIG network service temporary down Dec. 21, 2001
- NIG (National Institute of Genetics) network service will be unavailable
during the following dates because of the network maintenance.
- Thank you for your understanding and cooperation.
- Dec. 27 (Thu) 15:00 - 28 (Fri) 9:00
-
- Extended version of CLUSTALW by DDBJ was released Dec. 20, 2001
- CLUSTALW is
the program for multiple alignment and tree-making. DDBJ released an extended
version of CLUSTALW on Dec. 7, 2001. The extended options are as follows:
- - When you specify ALIGN "on" for multiple alignments, dot option is
available. In this description, identical part of the sequences are indicated
as dot (see example).
- - When you specify TREE "on" to reconstruct a phylogenetic tree from
nucleotide sequences, as a method for estimation of a genetic distance,
Tamura, Tajima-Nei, Gojobori-Ishii-Nei 6-parameter and Tamura-Nei as well as
Jukes-Cantor and Kimura 2-parameter, can be selected.
example :
CLUSTAL W (1.81) multiple sequence alignment
A1-1_A101 GGCCGACCCTTCGGCCCGGGGGCC
A1-2_A102 ......T.................
A1-3_A103 NNNN..T.T...............
A1-4_A104 NNNN.G..................
A2 NNNN..T................-
AX NNNN......A.............
A3-1 NNNN................A...
cis-AB NNNN..T...........C.....
O-1_O101 ....-...................
O-2_O201 TATT-G....A.A..T...A....
O-3 NNNN.G.G.........A......
O-4_O102 NNNN-....C..............
O-5_O103 NNNN-G..................
O-6_O202 NNNN-.....A.A..T...A....
O-7_O203 NNNN-G....A.A.TT...A....
B-1_B101 .....G.G...T.A..A.C..A..
B-2_B102 NNNN.G.G...T.A..A.C.....
B-3_B103 NNNN.G.G.....A..A.C..A..
B(A) NNNN.G.G........A.C..A..
B3-1 NNNN.G.G...T.A..A.C..AT.
************************
|
- Updates of "Conference on information biology" Dec.19, 2001
- Evolution 2002 (June 28-July 2, 2002) and
Bio China 2002 (August 28-31, 2002)
were added to "Conference on information biology".
- Agrobacterium tumefaciens C58 (Dupont) was added to GIB Dec. 18, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequence data of Agrobacterium
tumefaciens C58 (Dupont) was released, we incorporated it to GIB,
and now you can search those data.
- Institute: University of Washington
- Reference: The Genome of the Natural Genetic Engineer Agrobacterium
tumefaciens C58, Science 294 (5550), 2317-2323 (2001)
- Ralstonia solanacearum GMI1000 was added to GIB Dec. 12, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequence data of Ralstonia solanacearum
GMI1000 was released, we incorporated it to GIB, and now you can search
those data.
- Institute: Genoscope and CNRS UMR-8030
- Reference: Genome sequence of the plant pathogen Ralstonia
solanacearum, Unpublished
- Version-up of TXSearch Dec. 11, 2001
- TXsearch is a retrieval system for a Taxonomy Database unified by DDBJ,
GenBank and EMBL. DDBJ released TXSearch Version 2.0 on Dec. 7, 2001.
The main purpose of this version-up was to accommodate the system to RDB.
Although no function was newly added, the maximum number of retrieval
results was changed from 1000 to infinity.
- Suspension of the DDBJ activity during the New Year Holidays Dec. 7, 2001
- We at DDBJ will suspend our business during the New Year Holidays
from December 29th, 2001 to January 3rd, 2002.
We will stop most activities including receiving data and issuing
accession numbers during that period, and resume the normal business
on January 4th, 2002.
- Please note in particular that SAKURA will stop in
operation from December 26th, 2001 to January 3rd, 2002.
- Thank you very much for your understanding and cooperation.
- We wish you a Merry Christmas and Happy New year.
- DNA Data Bank of Japan
- PIR rel. 70 was released Dec. 6, 2001
- PIR Rel. 70 was released on Dec. 6, 2001 at DDBJ. PIR Rel. 70 consists of
250,417 entries, and the total number of residues reached 85,931,133 aa.
- Nostoc sp. PCC 7120 was added to GIB Dec. 5th, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequencedata of Nostoc sp. PCC 7120
was released, we incorporated it to GIB, and now you can search those data.
- Institute: Kazusa DNA Research Institute
- Reference: Complete Genomic Sequence of the Filamentous
Nitrogen-fixing Cyanobacterium Anabaena sp. strain PCC 7120, DNA Res. 8,
205-213 (2001)
- PRF Rel. 82 was released Dec. 5th, 2001
- PRF (Protein Research Foundation)/SEQ database Release 82 was released on
Dec. 4, 2001 at DDBJ. PRF Release 82 consists of 184,903 entries, and the
total number of residues reached 66,779,128.
- NIG network service temporary down Nov. 29, 2001
- NIG (National Institute of Genetics) network service will be
unavailable during the following date because of the network maintenance.
Thank you for your understanding and cooperation.
- Dec. 1st (Sat) 13:00 - 21:00
- Recovery of the DDBJ web pages Nov. 27, 2001
- Due to an accident of the server maintenance, some pages could not be
accessed from Nov. 17 to 26. They are recovered now.
- We apologize for the inconvenience and thank you for your understanding.
- DAD rel. 17 was released Nov. 27, 2001
- DDBJ amino acid database (DAD) Release 17 was released on Nov. 19,
2001 at DDBJ. DAD Release 17 consists of 863,193 entries, and the total
number of residues reached 265,285,159.
- SWISS-PROT Rel. 40 was released Nov. 27, 2001
- SWISS-PROT Rel. 40 was released on Nov. 19, 2001 at DDBJ.
SWISS-PROT Rel. 40 consists of 101,602 entries,
and the total number of residues reached 37,315,215.
-
Reopen the DDBJ release in XML (DDBJ-XML V.1.1) Nov. 14, 2001
- DDBJ reopened the whole release retrieve service in XML format.
- XML formatted files of DDBJ release 47 (Dec. 2001) can be retrieved
through the following anonymous FTP:
- ftp://ftp.ddbj.nig.ac.jp/ddbj_database/ddbj/xml/
- DDBJ started to provide unified daily update data (NEW data) in XML format.
- Newly-arrived/updated entries after the last release are now available
through the following anonymous FTP:
- ftp://ftp.ddbj.nig.ac.jp/ddbj_database/ddbjnew/xml/
- NIG network service temporary down Nov. 8, 2001
- NIG (National Institute of Genetics) network service will be unavailable
during the following dates because of the electric power cut.
We appreciate your cooperation.
- Nov. 16 (Fri) 17:00 - 18 (Sun) 9:00
- Listeria innocua Clip11262 and Listeria monocytogenes EGD-e were added to GIB Nov. 1st, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
- Because the genome sequence data of Listeria innocua Clip11262 and
Listeria monocytogenes EGD-e were released, we incorporated them to GIB,
and now you can search those data.
- Institute: Institut Pasteur
- Reference:
Comparative genomics of Listeria species, Science 294, 849-852 (2001)
- Salmonella typhi CT18 was added to GIB Oct. 31, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
- Because the genome sequence data of Salmonella typhi CT18 was
released, we incorporated it to GIB, and now you can search those data.
- Reference:
Complete genome sequence of a multiple drug resistant Salmonella enterica
serovar Typhi CT18, Nature 413, 848-852 (2001)
- Updates of "Conference on information biology" Oct. 29, 2001
- HGM 2002 (April 14-17, 2002)
and 4th HUGO Pacific Meeting and 5th
Asia-Pacific Conference on Human Genetics (October 27-30, 2002) were added
to "Conference on information biology".
- Salmonella typhimurium LT2 was added to GIB Oct. 29, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
- Because the following genome sequence data of Salmonella typhimurium
LT2was released, we incorporated it to GIB, and now you can search those
data.
- Reference:
The complete genome sequence of Salmonella enterica serovar Typhimurium LT2:
features revealed by comparison to related genomes, Nature 413, 852-856
(2001)
- PRF/SEQ database was added to DDBJ search services as a target database Oct. 25, 2001
- DDBJ added PRF (Protein Research Foundation)/SEQ database to DDBJ search
services (fasta, blast, psi-blast, ssearch and getentry) as a target database.
PRF/SEQ database Rel. 81 is available now.
Rel. 81 consists of 177,941 entries, and the total number of residues is
64,250,763 aa.
- * PRF/SEQ database consists of amino acid sequences of peptides and
proteins, including sequences deduced from genes collected by Protein Research
Foundation.
- Updates of "Conference on information biology" Oct. 23, 2001
- THE SIX SHIZUOKA FORUM ON HEALTH AND LONGEVITY
(November 9-10, 2001) was added to "Conference on information biology".
- Updates of "Conference on information biololgy" Oct. 22, 2001
- BGRS'2002
(July 14-20, 2002) was added to "Conference on information biology".
- Yersina pestis CO92 was added to GIB Oct. 16, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
- Because the genome sequence data of Yersina pestis CO92 was
released, we incorporated it to GIB, and now you can search those data.
- Reference:
Genome sequence of Yersinia pestis, the causative agent of plague, Nature
413, 523-527(2001)
- DDBJ Rel. 47 Completed Oct. 16, 2001
- The nucleotide sequence database collected and maintained by DDBJ is
quarterly released online to the public and distributed in the magnetic media.
We completed DDBJ Release 47 in Oct. 2001. DDBJ Release 47 consists of
13,266,610 entries, and the number of bases reached 14,145,671,645.
- supernig periodic maintenance Oct. 12, 2001
- Supernig service will be unavailable during the following date because
of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Oct. 19, 2001 (Fri) 12:00-21:00
- Updates of "Conference on information biology" Oct. 11, 2001
- Bioinformatics 2002
(February 6-8, 2002) was added to "Conference on information biology".
- Version-up of GIB Oct. 1st, 2001
- We enhanced GIB to version 3.0
to accommodate rapidly increasing genomic information. GIB 3.0 uses
distributed RDBs on multiple PC-Linux platforms and a homology search server
on Unix platform. The WWW server communicates with these servers by use of
CORBA and XML. The new version of GIB stores, processes and displays all the
features in the Flat Files including CDS and RNA. In a comparative genomes
page of GIB 3.0, you can select multiple genomes that you are interested in.
The user interface is improved in GIB 3.0 as well.
- Streptococcus pneumoniae R6,
Rickettsia conorii and Sulfolobus tokodaii were added to GIB Sep. 18, 2001
- GIB (Genome Information Broker for Microbial Genomes)
provides a comprehensive view of the complete microbial genome sequences.
- Because the following genome sequencedata were released, we
incorporated them to GIB, and now you can search those data.
- Streptococcus pneumoniae R6
- Institute: Eli Lilly and Company: Genome of the Bacterium
- Reference: Streptococcus pneumoniae Strain R6, J. Bacteriol. 183 (19),
5709-5717 (2001)
- Rickettsia conorii
- Institute: Genoscope, Universite de la Mediterranee
- Reference: Mechanisms of Evolution in Rickettsia conorii and
Rickettsia prowazekii, Science 293, 2093-2098 (2001)
- Sulfolobus tokodaii
- Institute: National Institute of Technology and Evaluation
- Reference: Complete genome sequence of an Aerobic
Thermoacidophilic Crenarchaeon, Sulfolobus tokodaii strain7. DNA Res.
(2001) In press
- Minerva periodic maintenance Sep. 14, 2001
- Minerva service will be unavailable during the following date
because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Sep. 21, 2001 (Fri) 10:00 a. m. - 22:00 p. m.
- Temporary stop of the XML format distribution Sep. 12, 2001
- DDBJ stopped data distribution in XML format temporary because of
a system trouble. It will recover in a week.
- Thank you very much for your understanding and cooperation.
- ERROR occurred in the HOMOLOGY SEARCH !!! Aug. 24, 2001
- We apologize to those who used:
- - either FASTA or BLAST
- - by sending query and getting results via the WWW interface (*)
- - during July 17th and August 23rd
- - to search the database "DDBJ all data (DNA)" and the division of "Invertebrate", "Plant" or "Bacteria"
- The system returned you wrong results.
- We express regret for your inconvenience caused by the error.
- (*) The information is valid, if you get results via E-mail.
- If you sent a query by E-mail and get the result by E-mail, you have valid results.
- Agrobacterium tumefaciens was added to GIB Aug. 17, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
- Because the genome sequencedata of Agrobacterium tumefaciens was
released, we incorporated it to GIB, and now you can search those data.
- Reference: Complete Genome Sequence of Agrobacterium tumefaciens
C58 (Rhizobium radiobacter C58), the Causative Agent of Crown Gall Disease
in Plants, Unpublishe
- Shinorhizobium meliloti was added to GIB Aug. 10, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
- Because the genome sequencedata of Shinorhizobium meliloti was
released, we incorporated it to GIB, and now you can search those data.
- Reference:
Analysis of the chromosome sequence of the legume symbiont Sinorhizobium
meliloti, Unpublished
- PIR rel. 69 was released Aug. 9, 2001
- PIR Rel. 69 was released on Aug. 9, 2001 at DDBJ.
PIR Rel.69 consists of 232,624 entries, and the total number of residues
reached 80,607,033 aa.
- Arbidopsis thaliana was added to GIB Aug. 7, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
GIB is now not only for microbes but also Arbidopsis thaliana.
The genome sequence of Arabidopsis thaliana is retirievable in the Genome
Information Broker (GIB)
- DAD rel. 16 was released Aug. 3rd, 2001
- DDBJ amino acid database (DAD) Release 16 was released on Aug. 3rd, 2001
at DDBJ. DAD Release 16 consists of 797,764 entries, and the total number of
residues reached 245,236,540.
- Clostidium acetobutylicum was added to GIB Jul. 31, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequencedata of Clostidium
acetobutylicum was released, we incorporated it to GIB, and now you can
search those data.
- Reference:
Genome Sequence and Comparative Analysis of the Solvent-Producing Bacterium
Clostridium acetobutylicum, J. Bacteriol. 183 (16), 4823-4838 (2001)
- The DDBJ release is now available also in XML Jul. 25, 2001
- DDBJ now applied XML not only to entry by entry but also to the whole
release in July 2001. XML formatted files of DDBJ release 46 (July 2001) can
be retrieved through the following anonymous FTP:
- ftp://ftp.ddbj.nig.ac.jp/ddbj_database/ddbj/xml/
- DDBJ Release in XML
- Copyright 2001 National Institute of Genetics, Center for
Information Biology and DNA Data Bank of Japan. No reproduction or
republication in any form without written permission.
- Reference:
- Miyazaki S and Sugawara H, "Development of DDBJ-XML and its
application to a database of cDNA" , Genome Informatics 2000, Universal
Academy Press, Inc (Tokyo), 380-381, 2000
- Miyazaki S and Sugawara H, "Visualization of features in flat file
by use of DDBJ-XML", Currents in Computational Molecular Biology 2001
(Montreal), 249-250, 2001
- Streptococcus pneumoniae was added to GIB Jul. 25, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequencedata of Streptococcus
pneumoniae was released, we incorporated it to GIB, and now you can search
those data.
- Reference: Complete Genome Sequence of a virulent isolate of
Streptococcus pneumoniae, Science 293 (5529), 498-506 (2001)
- Updates of "Conference on information biology" July 25, 2001
- The Fourth International Workshop on
Advanced Genomics From Genomics to Proteomics
(November 13-14, 2001) was added to "Conference on information biology".
- DDBJ Rel. 46 Completed Jul. 17, 2001
- The nucleotide sequence database collected and maintained by DDBJ is
quarterly released online to the public and distributed in the magnetic media.
We completed DDBJ Release 46 in Jul. 2001.
- DDBJ Release 46 consists of 12,313,759 entries, and the number of bases
reached 13,037,646,166.
- "DDBJ/CIB Human Genomics Studio" service reopening Jul. 16, 2001
- We reopened
"DDBJ/CIB Human Genomics Studio" service.
We appreciate your cooperation.
- Minerva periodic maintenance Jun. 14, 2001
- Minerva service will be unavailable during the following date because
of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Jun. 22, 2001 (Fri) 12:00-21:00
- supernig periodic maintenance Jun. 14, 2001
- Supernig service will be unavailable during the following date because
of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Jun. 22, 2001 (Fri) 16:00-21:00
- Thermoplasma volcanium was added to GIB Jun. 7, 2001
- GIB (Genome Information Broker for
Microbial Genomes)
provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of Thermoplasma volcanium was released,
we incorporated it to GIB, and now you can search those data.
- Reference: Determination of the complete genomic DNA sequence
of Thermoplasma volcanium, Proc. Natl. Acad. Sci. U.S.A. 97, 14257-14262 (2000)
- Mesorhizobium loti was added to GIB May 31, 2001
- GIB (Genome Information Broker for Microbial Genomes)
provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of Mesorhizobium loti was released,
we incorporated it to GIB, and now you can search those data.
- Reference: Complete genome structure of the nitrogen-fixing
symbiotic bacterium Mesorhizobium loti., DNA Res. 7, 331-338 (2000)
- Updates of "Conference on information biology" May.25, 2001
- The 2001 Annual Meeting of the CBI Society (July 25-27, 2001),
The 8th International Congress on Endocytobiology and Symbiosis (October 12-17, 2001) and
Evolutionary Genomics - New Paradigm of Biology in the 21st Century
(November 4-6, 2001) were added to "Conference on information biology".
- Updates of "Conference on information biology" May 24, 2001
- Artificial Intelligence and
Heuristic Methods for Bioinformatics
(October 1-11, 2001) was added to "Conference on information biology".
- Mycoplasma pulmonis was added to GIB May 22, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequencedata of Mycoplasma pulmonis
was released, we incorporated it to GIB,and now you can search those data.
- Reference: The complete genome sequence of the murine respiratory
pathogen Mycoplasma pulmonis, Nucleic Acids Res. 29(10), 2145-2153(2001)
- PIR rel. 68 was released May 21, 2001
- PIR Rel. 68 was released on May 21, 2001 at DDBJ. PIR Rel.68 consists
of 219,241 entries, and the total number of residues reached 76,174,552 aa.
- Updates of "Conference on information biology" May.16, 2001
- The Ribosome
(May 31-June 5, 2001),
Mechanisms of Cell Death and Disease:Advances in Therapeutic Intervention
(June 2-5, 2001) , Bioinformatics Tools for Comparative Genomics (June 11-15, 2001) and
PharmaConference '01
(August 5-9, 2001) were added to "Conference on information biology".
- Staphylococcus aureus Mu50,
Sulfolobus solfataricus and Mycobacterium tuberculosis CDC1551
were added to GIB May. 14, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the following genome sequencedata
were released, we incorporated them to GIB,and now you can search those data.
- Staphylococcus aureus Mu50
- Reference:
Whole genome sequencing of methicillin-resistant Staphylococcus aureus, the
major hospital pathogen, Lancet 357, 1225-1240 (2001)
- Institute:
University of Tsukuba College of Medical Technology and Nursing
- Sulfolobus solfataricus
- Reference:
Unpublished
- Institute:
Copenhagen University
- Mycobacterium tuberculosis CDC1551
- Reference:
Whole genome comparison of Mycobacterium tuberculosis clinical and
laboratory strains, Unpublished
- Institute:
The Institute for Genomic Research
- DDBJ introduced XML May 11, 2001
- DDBJ introduced XML for the data dissemination and named it DDBJ-XML.
XML format is firstly implemented into a DDBJ search program named
"getentry".
- You could choose XML format from a pull-down menu of "getentry".
- You could also find a link to the DTD file when you get the result of "getentry".
- Reference:
- Miyazaki, S and Sugawara, H, "Development of DDBJ-XML and Its
Application to a Database of cDNA" , Genome Informatics 2000, Universal
Academy Press, Inc (Tokyo),380-381,2000
- Satoru Miyazaki and Hideaki Sugawara,"Visualization of Features
in Flat file by use of DDBJ-XML", Currents in computational molecular
biology 2001(Montreal), 249-250, 2001
- DAD Rel.15 was released Apr. 27, 2001
- DDBJ amino acid database (DAD) Release 15 was released on Apr. 26th, 2001
at DDBJ. DAD Release 15 consists of 741,845 entries, and the total number of
residues reached 228,137,184.
- Staphylococcus aureus was added to GIB Apr. 26, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequencedata of Staphylococcus
aureus was released, we incorporated it to GIB,and now you can search
those data.
- Reference: Whole genome sequencing of meticillin-resistant
Stapylococcus aureus, The Lancet 357, 1225-1240 (2001)
- supernig periodic maintenance Apr. 23, 2001
- suprenig service will be unavailable during the following date because of
the periodic maintenance and upgrade of Operating system (Solaris8).
In connection with Upgrade of Operating system, recompilation may be needed
with a part of program.
- Thank you very much for your understanding and cooperation.
- 9:00 a.m, Monday May 7 - 9:00 a.m, Thursday May 10
- DDBJ Rel. 45 Completed Apr. 17, 2001
- The nucleotide sequence database collected and maintained by DDBJ is
quarterly released online to the public and distributed in the magnetic media.
We completed DDBJ Release 45 in Feb. 2001. DDBJ Release 45 consists of
11,434,113 entries, and the number of bases reached 12,207,092,905.
From the present release, we include a new division, HTC (High Throughput cDNA).
- Streptococcus pyogenes was added to GIB Apr. 16, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequencedata of Streptococcus
pyogeneswas released, we incorporated it to GIB,and now you can search
those data.
- Reference: Complete genome sequence of an M1 strain of
Streptococcus pyogenes.,
Proc. Natl. Acad. Sci. U.S.A. 98 (8), 4658-4663 (2001)
- minerva (VPP5000) periodic maintenance Apr. 16, 2001
- minerva (VPP5000) service will be unavailable during the following date
because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Apr. 20th, 2001 (Fri) 12:00-21:00
- CIB renamed CIB/DDBJ Apr. 6, 2001
-
The Center for Information Biology (CIB) of the National Institute of
Genetics (NIG) changed its name to "the Center for Information Biology
and DNA Data Bank of Japan (CIB/DDBJ)" in April 2001.
Since DDBJ began its operations in 1986, it had been regarded as a
project of the DNA Research Center and then as a project of CIB.
Now DDBJ is officially recognized as an organization of NIG, and
continues its activities as ever.
- Updates of "Conference on information biology" Apr. 4, 2001
-
Antisense 2001 (May 21-22, 2001),
Beyond Genome 2001 (June 17-22, 2001) and
13th International Genome Sequencing and Analysis Conference
(October 25-28, 2001) were added to "Conference on information biology".
- Caulobacter crescentus was added to GIB Mar. 27, 2001
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequencedata of Caulobacter
crescentus was released, we incorporated it to GIB,and now you can search
those data.
- Announcement of temporary shutdown of the DDBJ web home page Mar. 26, 2001
- Web homepage of DDBJ will have temporary shutdown during the following date
due to server maintenance.
You cannot access DDBJ web homepage (http://www.ddbj.nig.ac.jp/) during that period.
Thank you very much for your understanding and cooperation.
- March 29 (Thu), 2001 10:00am - 12:00
- Updates of "Conference on information biology" Mar. 26, 2001
- MICROARRAYS AND MICROCHIPS JAPAN (June 4-5, 2001) and
WABI 2001 (August 28-31, 2001)
were added to "Conference on information biology".
- Mycobacterium leprae was added to GIB Mar. 5, 2001
- GIB (Genome Information Broker for Microbial Genomes)
provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of Mycobacterium leprae was
released, we incorporated it to GIB,and now you can search those data.
- Updates of "Conference on information
biology" Feb. 20, 2001
-
SMBE 2001 ANNUAL MEETING (July 7-10, 2001) was added to "Conference
on information biology".
- Publication of human genome draft sequences Feb. 19, 2001
- Article on human genome draft sequences was published in
Nature,
February 15 (vol. 409, pp. 860-921) by International Human Genome Sequencing
Consortium. == details ==
- Updates of "Conference on information biology" Feb. 14, 2001
- Genome Japan
(March 26-27, 2001) and Genome Informatics Workshop 2001 (December 18-19, 2001) were added to
"Conference on information biology".
- Pasteurella multocida and
Lactococcus lactis were added to GIB Feb. 5, 2001
- GIB (Genome Information Broker
for Microbial Genomes) provides a comprehensive view of the complete
microbial genome sequences.
Because the genome sequencedata of Pasteurella multocida and
Lactococcus lactis were
released, we incorporated them to GIB,and now you can search those data.
- DAD Rel.14 and PIR Rel.67 were released Feb. 13, 2001
- DDBJ amino acid database (DAD) Release 14 and PIR Release 67 were
released on Feb. 9th, 2001 at DDBJ.
DAD Release 14 consists of 662,374 entries, and the total number of residues
reached 205,640,609.
PIR Release 67 consists of 198,801 entries, and the total number of residues
reached 68,722,935.
- Updates of "Conference on information biology" Feb. 9, 2001
-
RECOMB Satellite Meeting on DNA Sequence Assembly
(May 19-20, 2001),
Fifth Annual Conference On Computational Genomics
(November 29-December 1, 2001) and
Pacific Symposium on Biocomputing 2002
(January 3-7, 2002) were added to "Conference on information biology".
- 19,168 full-length mouse cDNAs with function annotation have been made public Feb. 8, 2001
- Sequences of Mus musculus cDNA (full-length, with annotation on their
function) have been submitted to DDBJ by Dr. Y. Hayashizaki (Project Director)'s
team at the RIKEN (Institute of Physical and Chemical Research) Genomic
Sciences Center. We assigned accession numbers AK002213-AK018700 (16,454
entries), AK018701-AK021412 (2,712 entries) , AK027261-AK027262 (2 entries)
to these sequences, and released them in the HTC division of the
DDBJ/EMBL/GenBank International Nucleotide Sequence Database.
The sequences were also published in Nature 409, 685-690 (8/2/2001).
- E.coli O157:H7 was added to GIB Feb. 5, 2001
- GIB (Genome Information Broker
for Microbial Genomes) provides a comprehensive view of the complete
microbial genome sequences.
Because the genome sequencedata of E.coli O157:H7 was
released, we incorporated it to GIB,and now you can search those data.
- Renewal of DDBJ WWW Home Page Feb. 1, 2001
- We started web home page of DDBJ in December 1994, and this web server
include many services such as "Data Submission" and"Database Search and
Analysis".
We renewed our home page in the end of January.
The basic color is navy blue and headlines were divided into two.
There are link buttons to major items in the left side.
Key word search, site map, and jump button are also available in this new
system. The URL is
[http://www.ddbj.nig.ac.jp/].
(not changed)
["Other Databases moved to
"Links to
information biology databases".]
- DDBJ Rel. 44 Completed Jan. 31, 2001
- The nucleotide sequence database collected and maintained by
DDBJ is quarterly released online to the public and distributed in
the magnetic media. We completed DDBJ Release 44 in Jan. 2001.
- DDBJ Release 44 consists of 10,165,597 entries, and the number
of bases reached 11,136,298,841.
- Updates of "Conference on information biology" Jan. 31, 2001
-
The 6th International Symposium on Genome Science in the 21st Century
(March 14-17, 2001) was added to "Conference on information biology".
- LIBRA I updates Jan. 30, 2001
- A computer application of threading:
LIBRA I was improved.
Structural library of LIBRA was enlarged to about 3,000 structures
- Supernig system shutdown due to hardware replacement Jan. 30, 2001
-
We at NIG are going to replace the computer system VPP500 with VPP5000
in order to catch up with the steep increase in the DNA data and the
various needs of research today. We are also going to introduce a new
server (PrimePower M2000).
Accordingly, we will stop the supernig system as follows.
We appreciate your understanding and cooperation.
-
- The system (front end processor) is scheduled to be shutdown from Feb. 12 to Feb. 15.
The new system is scheduled to start on Friday, Feb. 16.
（Detail）
- The system (back end processor) is scheduled to be shutdown from Feb. 12
to Feb. 25.
The new system is scheduled to start on Feb. 26 (Mon.).
（Detail）
|
- Announcement of temporary shutdown of the DDBJ web home page Jan. 26, 2001
- Web home page of DDBJ will have temporary shutdown due to its server
exchange.
- Scheduled shutdown time is 15:00 - 16:00, Monday, January 29.
- You cannot access DDBJ web homepage (
http://www.ddbj.nig.ac.jp/) during that time period.
This sever change is coupled with major change of web home page.
- Thank you for your understanding and cooperation.
- Updates of "Conference on information biology" Jan.26, 2001
-
GEMINI - Genes and Minds Initiative: Workshop on Ape Genomics
(March 14-15, 2001) was added to "Conference on information biology".
- DDBJ will stop accepting submissions by 'Authorin' and 'Submission Form' Jan. 25, 2001
- DDBJ is now developing a new data management system to cope more
efficiently with a large amount of incoming data.
The new data management system is expected to be in operation from April
1st, 2001.
Since the new system no longer accommodates data presented in 'Authorin'
or 'Submission Form', DDBJ will stop accepting data in those two forms
from April 1st, 2001.
- Please use the WWW submission tool, SAKURA instead of the two forms.
- Thank you very much for your understanding and cooperation.
- Supernig periodic maintenance Jan. 12, 2001
- Supernig service will be unavailable during the following date
because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Jan. 19, 2001 (Fri) 12:00 - 21:00
- Updates of "Conference on information biology" Jan. 10, 2001
-
5th evolutionary biology meeting (June 27-29, 2001) was added to
"Conference on information biology".
|
