 |
 |
 |
|
|
 |
|
|
 |
 |
|
|
|
 |
|
Contact Us
|
Copyright © 1995-2006
DDBJ All rights reserved. |
|
 Updates of "Conference on information biology" Dec. 26, 2003
- Following conferences was added to "Conference on information biology".
-
- DDBJ Rel. 56 Completed Dec. 24, 2003
- The nucleotide sequence database collected and maintained by DDBJ is
quarterly released online to the public.
We completed DDBJ Release 56 in Dec, 2003.
DDBJ Release 56 consists of 30,405,173 entries, and the number of bases
reached 36,079,046,032.
- FTP site for
periodical release and new data download
-
- Geobacter sulfurreducens PCA was added to GIB Dec. 22, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Geobacter sulfurreducens PCA
was released, we incorporated it to GIB, and now you can search those data.
- Institute: TIGR
- Reference: Genome of Geobacter sulfurreducens: metal reduction in
subsurface environments, Science 302 (5652),1967-1969 (2003)
-
- Supernig periodic maintenance Dec. 12, 2003
- Supernig service will be unavailable during the following date because
of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Dec. 19 (Fri) 12:00- 21:00
-
- Data were added to GIB Dec. 11, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Rhodopseudomonas palustris CGA009
and Onion yellows phytoplasma were released, we incorporated it to GIB,
and now you can search those data.
- References (Institutes):
- Rhodopseudomonas palustris CGA009 (JGI):
- Complete genome sequence of the metabolically versatile
photosynthetic bacterium Rhodopseudomonas palustris, Unpublished.
- Onion yellows phytoplasma (The University of
Tokyo):
- Reductive evolution suggested from the complete genome
sequence of a plant-pathogenic phytoplasma, (er) Nature Genetics,
10.1038/ng1277 (2003)
- Reductive evolution suggested from the complete genome sequence of
a plant-pathogenic phytoplasma, Nature Genetics (2004) In press
-
- Suspension of the DDBJ activity during the New Year Holidays Dec. 9, 2003
- We at DDBJ will suspend our business for receiving and releasing data
during the New Year Holidays from December 27th, 2003 to January 4th, 2004.
- We will resume the normal business on January 5th, 2004.
- Please note in particular that SAKURA will stop in operation from
December 26th, 2003 to January 4th, 2004 and the new
daily update will not be released from December 27th to January 5th, 2004.
- Thank you very much for your understanding and cooperation.
- We wish you a Merry Christmas and Happy New Year.
-
- DNA Data Bank of Japan
-
- PRF Rel. 94 was released Dec. 5, 2003
- PRF (Protein Research Foundation)/SEQ database Release 94 was released on
Dec. 5th, 2003 at DDBJ. PRF Release 94 consists of 239,691 entries, and the
total number of residues reached 85,245,893.
-
- Change in "BASE COUNT line" of the DDBJ flat file Dec. 3, 2003
- The BASE COUNT line of the DDBJ flat file format will be changed from DDBJ
release 56 (Dec. 2003), corresponding to the relaxation of the maximum
sequence length restriction（350,000 bp/entry）in the entry that had been
practised at DDBJ/EMBL/GenBank International Nucleotide Sequence Databases.
- In the BASE COUNT line of the DDBJ flat file format, 6 digits had been
allocated for each number of a, c, g, t and other bases in the sequence.
Hereafter, in the new flat file format, 9 digits are allocated for each number
of a, c, g and t, while the numbers of other bases are removed.
- In accordance with the relaxation of sequence length limitation, GenBank
had already dropped the BASE COUNT line from their flat file format from
GenBank Release 138 (Oct. 2003).
- We DDBJ have decided to maintain the BASE COUNT line in our flat file
format from the view that GC contents are still important information to
characterize the sequence.
- Prior to publication of release 56 in December, 2003, the new DDBJ flat
file format is adopted to daily data update from Dec. 3.
- Following is an example of the new BASE COUNT line.
-
= = = = = = = = example = = = = = = = =
1 6 11 16 21 26 31 36 41 46 51 56 61 66 71
|----|----|----|----|----|----|----|----|----|----|----|----|----|----|
BASE COUNT 123456789 a 123456789 c 123456789 g 123456789 t
|
- For detailed explanation of flat files of DDBJ format, please refer to
Guidance for Nucleotide Sequence Data Submission to DDBJ
(Guidance 10. Explanation of DDBJ flat file format)
- If you have any questions about the change, please send an e-mail to
ddbj@ddbj.nig.ac.jp.
- Thank you very much for your understanding and cooperation.
-
- PIR rel. 78 was released Nov. 27, 2003
- PIR rel. 78 was released on Nov. 26, 3003 at DDBJ.
PIR rel. 78 consists of 283,348 entries, and the total number of residues
reached 96,183,374 aa.
-
- NIG Network service temporary down Nov. 21, 2003
- NIG (National Institute of Genetics) network service will be unavailable
at the following schedule because of the planned blackout and network
maintenance. DDBJ network service and NIG supercomputer (supernig and
minerva) service will also be unavailable. Thank you very much for your
understanding and cooperation.
- Nov. 28(FRI) 17:00 - Nov. 29(SAT) 23:00
-
- The new phylum data was submitted to DDBJ Nov. 18, 2003
- Gemmatimonas aurantiaca, a new bacteria identified by
National Institute of Advanced Industrial Science and Technology (AIST) was approved as a new "Phylum" by ICSP*.
- The new phylum name "Gemmatimonadetes" was appeared in Int. J. Syst. Evol.
Microbiol. 53, 1155-1163 (2003) in this July.
By this new approval, bacteria are classified into 24 phylums.
- DNA data of Gemmatimonas aurantiaca had been submitted to DDBJ, and
assigned an accession number
AB072735.
The data are available by DDBJ getentry.
- Gemmatimonas aurantiaca
- Lineage (full)
- cellular organisms; Bacteria;
Gemmatimonadetes; Gemmatimonadetes (class);
Gemmatimonadales; Gemmatimonadaceae; Gemmatimonas
- *ICSP: International Committee on Systematics of Prokaryotes
-
- Minerva temporarily down (today!) Nov. 12, 2003
- Minerva service will be unavailable today because of the maintenance.
Thank you very much for your understanding and cooperation.
- Nov. 12 18:00-20:00 (Today!)
-
- Corynebacterium diphtheriae gravis NCTC13129 was added to GIB Nov. 10, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences. Because the genome sequence data of Corynebacterium
diphtheriae gravis NCTC13129 was released, we incorporated it to GIB,
and now you can search those data.
- Institute: Sanger Institure
- Reference: The complete genome sequence and analysis of
Corynebacterium diphtheriae NCTC13129, Nucleic Acids Res. 31(22),
6516-6523(2003)
-
- Addition of download menu to GIB Nov. 7, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete genome
sequences.
- New menu "List of gene name, GC %, and GC skew" was added to GIB
chromosome and plasmid download site on Nov. 5.
You can download GC % and GC skew of each gene at once.
- Download menu also provides "Whole genome flat file (DDBJ or FASTA
format)", "DNA sequences of all features (FASTA format)" and "Amino acid
sequences of CDS (FASTA format)" etc.
This menu appears in the left blue frame when the organism name was selected.
-
- Updates of "Conference on information biology" Nov. 5, 2003
- Following conferences was added to "Conference on information biology".
-
- Updates of "Conference on information biology" Oct. 28, 2003
- Following conferences were added to "Conference on information biology".
-
- DAD rel.25 and SWISS-PROT rel.42 were released Oct. 24, 2003
- DDBJ amino acid database (DAD) Release 25 and SWISS-PROT release 42 were
released on Oct. 23, 2003 at DDBJ. DAD Release consists of 1,547,330 entries,
and the total number of residues reached 478,115,729.
- SWISS-PROT release consists of 135,850 entries, and the total number of
residues reached 50,046,799.
- FTP site for DB download
-
- Version-up of BLAST, FASTA, SSEARCH (forthcoming) Oct.15, 2003
- BLAST, FASTA, SSEARCH of DDBJ homology search services provided through web and E-mail, are to be updated.
Version information and update schedule are as follows.
Service is not interrupted.
- BLAST: 2.0.11 -> 2.2.6
- FASTA: FASTA32t09 -> FASTA34t21
- SSEARCH: FASTA32t09 -> FASTA34t21
- Oct. 17, 2003 (Fri.) at 10:00 AM
-
- User interface is not changed by this version-up, though there are some changes in the result forms for FASTA and SSEARCH.
-
- NIG Network service temporary down Oct. 15, 2003
- NIG (National Institute of Genetics) network service will be unavailable
at the following schedule because of the network maintenance.
DDBJ network service and NIG supercomputer (supernig and minerva) service
will also be unavailable. Thank you very much for your understanding and
cooperation.
- Oct. 21 (TUE) 18:00- 22:00
-
- Vibrio vulnificus YJ016 was added to GIB Oct. 14, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Vibrio vulnificus YJ016
was released, we incorporated it to GIB, and now you can search those data.
- Institute: National Yang Ming University
- Reference: Comparative Genome Analysis of Vibrio vulnificus,
a Marine Pathogen, Unpublished (2003)
-
- PRF Rel. 93 was released Oct. 9, 2003
- PRF (Protein Research Foundation)/SEQ database Release 93 was released on
Oct. 9th, 2003 at DDBJ. PRF Release 93 consists of 236,775 entries, and the
total number of residues reached 84,294,838.
-
- Chimpanzee Chromosome 22 genomic sequences released Oct. 7, 2003
- DDBJ (DNA Data Bank of Japan) released chimpanzee (Pan troglodytes)
chromosome 22 genomic nucleotide sequence data on October 7.
- Sequencing was conducted by the following eight institutions: two Japanese
groups (RIKEN GSC and National Institute of Genetics), three German groups
(Max Planck Institute for Molecular Genetics, German Center for Biotechnology,
and Institute of Molecular Biotechnology), Chinese National Human Genome Center
at Shanghai, Korean Research Institute of Bioscience and Biotechnology
(KRIBB), and National Yang-Ming University at Taipei.
- Chimpanzee chromosome 22 corresponds to human chromosome 21, and
determination of entire chromosomal genomic sequence is the first for
non-human primates.
- Accession numbers released from DDBJ are BS000001-BS000245.
You can retrieve above entries via DDBJ getentry system:
http://getentry.ddbj.nig.ac.jp/top-e.html
-
- Updates of "Conference on information biology" Oct. 7, 2003
- Following conferences was added to "Conference on information biology".
-
- Data were added to GIB Oct. 1st, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Gloeobacter violaceus PCC 7421
and Photorhabdus luminescens subsp. laumondii TTO1 were released, we
incorporated them to GIB, and now you can search those data.
- References (Institutes):
- Gloeobacter violaceus PCC 7421 (Kazusa DNA Research
Institute):
Complete genome structure of Gloeobacter violaceus PCC 7421,
a cyanobacterium that lacks thylakoids, DNA Res. 10, 137-145 (2003)
Complete genome structure of Gloeobacter violaceus PCC 7421, a cyanobacterium
that lacks thylakoids (supplement), DNA Res. 10, 181-201 (2003)
- Photorhabdus luminescens subsp. laumondii TTO1 (Institut
Pasteur):
Complete genome sequence of the entomapathogenic bacterium Photorhabdus
luminescens, Nat. Biotechnol. 11(1),(2003),Unpublished.
-
- NIG Network service temporary down Oct. 1st, 2003
- NIG (National Institute of Genetics) network service will be unavailable
at the following schedule because of the network maintenance.
DDBJ network service and NIG supercomputer (supernig and minerva) service
will also be unavailable. Thank you very much for your understanding and
cooperation.
- Oct. 8 (Wed) 18:00- 22:00
-
- Statistics [Top 30 organisms according to the total number of nucleotides] Update Sep. 30, 2003
- Top 30 organisms according to the total number of nucleotides (- DDBJ rel.55) in DDBJ statistics was updated with releasing DDBJ Rel. 55.
- Zea mays subsp. mays (corn) ranked in 28th, it was 77th at previous release.
Click the organism name to view the graph of change.
-
- Scheduled stop of the GIB server Sep.19, 2003
- GIB server will be stopped for a machine maintenance.
- From Sep 26 (Fri) 13:00 pm to 18:00 pm
- Thank you very much for your cooperation.
-
- DDBJ Rel. 55 Completed Sep. 19, 2003
- The nucleotide sequence database collected and maintained by DDBJ is
quarterly released online to the public.
We completed DDBJ Release 55 in September 19, 2003.
DDBJ Release 55 consists of 27,753,140 entries, and the number of bases
reached 34,280,225,489.
-
- Updates of "Conference on information biology" Sep. 18, 2003
- Following conferences were added to "Conference on information biology".
-
- Wolinella succinogenes DSMZ 1740 was added to GIB Sep. 9, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Wolinella succinogenes DSMZ 1740
was released, we incorporated it to GIB, and now you can search those data.
- Institute: Max-Plank Institut
- Reference: Complete genome sequence and analysis of Wolinella
succinogenes, Unpublished.
-
- Data were added to GIB Sep. 8, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Chromobacterium violaceum ATCC 12472,
and Porphyromonas gingivalis W83 were released, we incorporated them to
GIB, and now you can search those data.
- References (Institutes):
- Chromobacterium violaceum ATCC 12472 (LNCC):
The complete genome sequence of Chromobacterium violaceum, reveals
remarkable and exploitable bacterial adaptability,
Proc. Natl. Acad. Sci. U.S.A. (2003) In press
- Porphyromonas gingivalis W83 (TIGR):
Complete Genome Sequence of the Oral Pathogenic Bacterium Porphyromonas
gingivalis Strain W83, J. Bacteriol. 185 (18), 5591-5601 (2003)
-
- [Homology Search] EST organism options change for DIVISION Sep. 5, 2003
- DDBJ provides homologous sequences search service by web site and e-mail.
You can select organisms in the DIVISION to search effectively
(this selection is valid only when "DDBJ ALL" or "DDBJ updates" is selected).
- From September 11, 2003, number of EST organism options for DIVISION in
the following services is changed from 31 to 22.
We include some subspecies into higher rank species, and delete some
organisms.
- services: FASTA, BLAST, SSEARCH, S&W SEARCH
- newly added organisms (EST):
Ciona intestinalis, Gallus gallus, Silurana tropicalis
- deleted organisms (EST):
Bombyx mori, Brugia malayi, Leishmania major, Neurospora crassa,
Onchocerca volvulus, Plasmodium falciparum, Rattus sp.,
Saccharomyces cerevisiae, Schistosoma mansoni,
Schizosaccharomyces pombe, Sus scrofa, Trypanosoma cruzi
-
- Network service temporary down Aug. 29, 2003
- Following service will be unavailable during the following date because of
the maintenance.
- Thank you very much for your understanding and cooperation.
- Sep. 1 (Mon) 18:00- 18:30
- getentry, SRS, SQmatch, Data Retrieval by key words using SFgate & WAIS,
Anonymous FTP
-
- Data were added to GIB Aug. 19, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Prochlorococcus marinus MED4,
Prochlorococcus marinus MIT9313, and Synechococcus sp. WH 8102
were released, we incorporated them to GIB, and now you can search those data.
- References (Institutes):
- Prochlorococcus marinus MED4 (JGI):
Genome divergence in two Prochlorococcus ecotypes reflects oceanic niche
differentiation, Nature [Epub ahead of print] (2003)
- Prochlorococcus marinus MIT9313 (JGI):
Genome divergence in two Prochlorococcus ecotypes reflects oceanic niche
differentiation, Nature [Epub ahead of print] (2003)
- Synechococcus sp. WH 8102 (JGI):
The genome of a motile marine Synechococcus, Nature [Epub ahead of print]
(2003)
-
- S&W search service maintenance Aug. 18, 2003
- The return of S&W search results will be delayed due to a maintenance of
the search engine from Aug 18 to Aug 19. Your request will be queued during
this period.
-
- Minerva periodic maintenance Aug. 18, 2003
- Minerva service will be unavailable during the following date because
of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Aug. 22 (Fri) 12:00- 21:00
-
- Data were added to GIB Aug. 13, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Candidatus Blochmannia floridanus,
Bordetella pertussis Tohama I, Bordetella parapertussis 12822 and
Bordetella bronchiseptica RB50 were released, we incorporated them to
GIB, and now you can search those data.
- References (Institutes):
- Candidatus Blochmannia floridanus (University of
Valencia): The genome sequence of Blochmannia floridanus: Comparative
analysis of reduced genomes., Proc. Natl. Acad. Sci. U.S.A. 100,
9388-9393 (2003)
- Bordetella pertussis Tohama I (Sanger Institute):
Comparative analysis of the genome sequences of Bordetella pertussis,
Bordetella parapertussis and Bordetella bronchiseptica. Nat. Genet. DOI,
10.1038/Ng1227-10.1038/Ng1227(2003).
- Bordetella parapertussis 12822 (Sanger Institute):
Comparative analysis of the genome sequences of Bordetella pertussis,
Bordetella parapertussis and Bordetella bronchiseptica,
Nat. Genet. DOI, 10.1038/Ng1227-10.1038/Ng1227(2003).
- Bordetella bronchiseptica RB50 (Sanger Institute):
Comparative analysis of the genome sequences of Bordetella pertussis,
Bordetella parapertussis and Bordetella bronchiseptica,
Nat. Genet. DOI, 10.1038/Ng1227-10.1038/Ng1227(2003).
-
- URL change of SFgate-WAIS Aug. 11, 2003
- SFgate-WAIS is data retrieval service by keywords provided on the DDBJ web.
The URL of SFgate-WAIS will be changed from August 18, 2003.
- New URL is:
- English http://dbsearch.ddbj.nig.ac.jp/dbsearch-e.html
- Japanese http://dbsearch.ddbj.nig.ac.jp/dbsearch-j.html
- (former URL: http://ftp2.ddbj.nig.ac.jp:8080/dbsearch-j-new.html)
- Old URL will be stopped on Septembsr 16, 2003. So, please update your
bookmarks and links. This change accompanies a change of the port number
from current #8000 to new #80 (standard port).
- Because of this change, troubles of accessing to SFgate-WAIS due to port
number mismatch will be solved. Contents of the service has no change.
- Thank you very much for your understanding and cooperation.
-
- URL change for ancient DNA database Aug. 8, 2003
- Ancient DNA Database (Ancient Genome Encyclopedia: AGE) is the database for ancient DNA, treating many information for DNA, such as extracted from human or animal bones which are excavated from ancient remains. This database is basically designed by Drs. Naruya Saitou, National Institute of Genetics, and
Shintaroh Ueda, The University of Tokyo, and maintained by DDBJ. The URL
was changed as follows:
- New URL: http://www.ddbj.nig.ac.jp/aDNA/
- (former URL:http://spinner.lab.nig.ac.jp/aDNA/)
- Please change your bookmarks as necessary.
-
- S&W search service reopening Aug. 4, 2003
- We resumed S&W search service on Aug. 1.
Thank you very much for your understanding and cooperation.
-
- S&W search service temporary down Jul. 29, 2003
- The S&W search service is unavailable because of the maintenance. Your
request will be queued and the result will be returned after the maintenance.
Thank you very much for your understanding and cooperation.
-
- NIG Network service temporary down Jul. 28, 2003
- NIG (National Institute of Genetics) network service will be unavailable
at the following schedule because of the SINET network maintenance.
- DDBJ network service and NIG supercomputer (supernig and minerva) service
will also be unavailable. Thank you very much for your understanding and
cooperation.
- Aug. 8(FRI), 12:00-13:00 (15 minutes)
-
- Data were added to GIB Jul. 28, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Chlamydophila pneumoniae TW-183,
Haemophilus ducreyi 35000HP, and Prochlorococcus marinus subsp.
marinus str. CCMP1375 were released, we incorporated them to GIB, and now
you can search those data.
- References (Institutes):
- -Chlamydophila pneumoniae TW-183 (ALTANA Pharmaceuticals):
The genome sequence of Chlamydia pneumoniae TW183 and comparison with other
Chlamydia strains based on whole genome sequence analysis,
Unpublished.
- -Haemophilus ducreyi 35000HP (Columbus Children's Research
Institute): The Complete Genome Sequence of Haemophilus ducreyi,
Unpublished.
- -Prochlorococcus marinus subsp. marinus str. CCMP1375
(Genoscope and Station Biologique de Roscoff): Genome sequence of the
cyanobacterium Prochlorococcus marinus SS120, a near minimal
oxyphototrophic genome, Unpublished.
-
- PRF Rel. 92 was released Jul. 24, 2003
- PRF (Protein Research Foundation)/SEQ database Release 92 was released on
Jul. 24, 2003 at DDBJ. PRF Release 92 consists of 233,109 entries, and the
total number of residues reached 83,162,444.
-
- Updates of "Conference on information biology" Jul. 22, 2003
- Following conferences were added to "Conference on information biology".
-
- PIR rel. 77 was released Jul. 16, 2003
- PIR rel. 77 was released on Jul. 16, 3003 at DDBJ.
PIR rel. 77 consists of 283,329 entries, and the total number of
residues reached 96,175,589 aa.
-
- NIG Network service temporary down--Cancelled 2003.7.14
- NIG (National Institute of Genetics) network service scheduled for today was cancelled.
- NIG Network service, DDBJ network service, and NIG supercomputer (supernig and minerva) service are available as usual.
-
- NIG Network service temporary down 2003.7.11
- NIG (National Institute of Genetics) network service will be stopped
at the following schedule because of the the planned blackout of the Institute.
- DDBJ network service and NIG supercomputer (supernig and minerva) service
will also be unavailable.
- Thank you very much for your understanding and cooperation.
- Jul. 14(MON) 18:00 - Jul. 15(TUE)11:00
-
- NIG Network service temporary down 2003.7.11
- NIG (National Institute of Genetics) network service will be unavailable
at the following schedule because of the network maintenance.
- DDBJ network service and NIG supercomputer (supernig and minerva) service
will also be unavailable.
- Thank you very much for your understanding and cooperation.
- Jul. 13(SUN), 2003 13:00 - 18:00
-
- Update of DDBJ top page 2003.7.10
- DDBJ top page was updated.
"FTP site for DDBJ release" and some other links are added.
-
- URL change of SQmatch Jul. 9, 2003
- SQmatch is a database search service provided on the DDBJ web. It was
developed by DDBJ for matching a regular expression against sequences in DDBJ
and DAD databases, and is useful for the search of short length sequences and
sequences which include "N".
- The URL of SQmatch will be changed from July 15, 2003.
- New URL is:
- English http://sqmatch.ddbj.nig.ac.jp/top-e.html
- Japanese http://sqmatch.ddbj.nig.ac.jp/top-j.html
- Old URL will be stopped on August 15, 2003. So, please update your
bookmarks and links. This change accompanies a change of the port number
from current #8000 to new #80 (standard port).
- Because of this change, troubles of accessing to SQmatch due to port number
mismatch will be solved. Contents of the service has no change.
- Thank you very much for your understanding and cooperation.
-
- Pirellula sp. strain 1 was added to GIB Jul. 4, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Pirellula sp. strain 1
was released, we incorporated it to GIB, and now you can search those data.
- Institute: MPIMM
- Reference: Complete genome sequence of the marine
planctomycete Pirellula sp. strain 1,
Proc. Natl. Acad. Sci. U.S.A. 100 (14), 8298-8303(2003)
-
- Update of "Links" for Information Biology Jul. 4, 2003
- Link to Other web pages on Information Biology was updated.
A lot of web information including SNP and gene-expression are newly added.
Please visit.
-
- DAD rel. 24 was releasedJul. 4, 2003
- DDBJ amino acid database (DAD) Release 24 was released on July 3rd, 2003
at DDBJ. DAD Release consists of 1,429,344 entries,
and the total number of residues reached 441,769,888.
- FTP site for DB download
-
- Helicobacter hepaticus ATCC 51449 was added to GIB Jul. 1st, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Helicobacter hepaticus ATCC 51449
was released, we incorporated it to GIB, and now you can search those data.
- Institute: MWG
- Reference: The complete genome sequence of the carcinogenic
bacterium Helicobacter hepaticus, Proc. Natl. Acad. Sci. U.S.A. 100 (13),
7901-7906 (2003)
-
- Statistics [Top 30 organisms according
to the total number of nucleotides] Update Jun. 27, 2003
- Top 30 organisms according to
the total number of nucleotides (- DDBJ rel.54) in
DDBJ statistics was updated with
releasing DDBJ Rel. 54.
- Macaca mulatta (rhesus monkey) ranked in 11th, it was 98th at
previous release.
Click the organism name to view the graph of change.
-
- DDBJ Rel. 54 Completed Jun. 23, 2003
- The nucleotide sequence database collected and maintained by DDBJ is
quarterly released online to the public.
We completed DDBJ Release 54 in June 23, 2003.
DDBJ Release 54 consists of 25,149,821 entries, and the number of bases
reached 32,162,041,177.
-
- DDBJ network services reopening 2003.6.17
- We resumed [search and analysis, FTP] services.
Thank you very much for your understanding and cooperation.
-
- DDBJ network services temporary down Jun. 16, 2003
- Following DDBJ network services are suspended temporarily because of the
network trouble. Thank you very much for your understanding and cooperation.
- [search and analysis , FTP]
-
- Supernig periodic maintenance Jun. 16, 2003
- Supernig service will be unavailable during the following date because
of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Jun. 20 (Fri) 12:00- 21:00
-
- Mycoplasma gallisepticum R was added to GIB Jun. 12, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Mycoplasma gallisepticum R was
released, we incorporated it to GIB, and now you can search those data.
- Institute: CEVR
- Reference: The complete genome sequence of the avian pathogen
Mycoplasma gallisepticum strain R, Microbiology (2003) In press
-
- Scheduled stop of the GIB server2003.6.10
- GIB server will be stopped for a machine maintenance.Thank you very much for your cooperation.
- From Jun 14 (Sat) 5:00 pm to Jun 15 (Sun) 8:00 am
-
- PRF Rel. 91 was released Jun. 9, 2003
- PRF (Protein Research Foundation)/SEQ database Release 91 was released on
Jun. 9th, 2003 at DDBJ. PRF Release 91 consists of 229,482 entries, and the
total number of residues reached 81,951,321.
-
- Updates of "Conference on information biology" Jun. 4, 2003
- Following conference was added to "Conference on information biology".
-
- NIG Network service temporary down May 27, 2003
- NIG (National Institute of Genetics) network service will be unavailable
at the following schedule because of the network maintenance.
- DDBJ network service and NIG supercomputer (supernig and minerva) service
will also be unavailable.
- Thank you very much for your understanding and cooperation.
- Jun. 3 (TUE), 2003 18:00 - 21:00
-
- New function was added to BLAST service May 23, 2003
- BLAST is
aprogram for homology search.
- DDBJ added new function for multiple query sequences to BLAST service.
You can now ask multiple query sequences at once.
- This function is only available when "E-mail" is selected as the way to
get result. Please use it.
Example of multiple query sequence (multi FASTA format):
>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
>my query sequence 2
GGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCGCTTCCCAGGCAACCTGCCTCACATG
CTTCGAGACCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAG
CTGGACAACATATTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAG
>my query sequence 3
ATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCAAC
TTTGCCCACGGACACAACTGCCATATCGCCTTACGGGAGATCATCGAAACTCTGAACAGC
CTCACAGAGCAGAAGACTCTGTGCACCAAGTTGACCATAACGGAC
|
-
- SAKURA temporarily down May 16, 2003
- In order to conduct the maintenance work, SAKURA will be stopped the
following date.
Thank you very much for your understanding and cooperation.
- From 9:00 to 10:00 May 19(Mon)
-
- EPD Data mirrored at DDBJ May 13, 2003
- To periodically update EPD(Eukaryotic Promotor Database) data which is
included in the category of DDBJ homology search service , DDBJ opened a
EPD mirror site .
It is also linked from
Anonymous FTP of the DDBJ
and "Link to Other
web pages on Information Biology" .
-
- PIR rel. 76 was released May 9, 2003
- PIR rel. 76 was released on May 9, 3003 at DDBJ.
PIR rel. 76 consists of 283,308 entries, and the total number of
residues reached 96,168,669 aa.
-
- Minerva periodic maintenance May 9,2003
- Minerva service will be unavailable during the following date because
of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- May 16 (Fri) 12:00- 21:00
-
- Data were added to GIB May 6, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
genome sequences.
Because the genome sequence data of Shigella flexneri 2a 2457T,
Nitrosomonas europaea ATCC 19718, and
Bacillus anthracis Ames
were released, we incorporated them to GIB, and now you can search those data.
- References(Institutes):
- -Shigella flexneri 2a 2457T(University of Wisconsin):
Complete Genome Sequence of the Q-fever Pathogen, Coxiella burnetii, Proc.
Natl. Acad. Sci. U.S.A. (2003) In press
- -Nitrosomonas europaea ATCC 19718(JGI):
Complete genome sequence of the ammonia oxidizing bacterium and obligate
chemolithoautotroph Nitrosomonas europaea, J. Bacteriol. 185(9), 2759-2773
(2003)
- -Bacillus anthracis Ames(TIGR):
Comparative genome sequencing for discovery of novel polymorphisms in
Bacillus anthracis, Science 296 (5575), 2028-2033 (2002)
- Sequence and organization of pXO1, the large Bacillus anthracis
plasmid harboring the anthrax toxin genes, J. Bacteriol. 181 (20),
6509-6515 (1999)
- The Genome Sequence of Bacillus anthracis Ames and Comparison to
Closely-Related Bacteria, Nature 423, 81-86 (2003)
-
- SINET network service temporary down May 1, 2003
- NIG (National Institute of Genetics) network service will be unavailable
during the following date because of the SINET network maintenance.
Thank you for your understanding and cooperation.
- May 3 (SAT) 16:00 - 17:00
-
- PRF Rel. 90 was released Apr. 30, 2003
- PRF (Protein Research Foundation)/SEQ database Release 90 was released
onApr. 30 at DDBJ. PRF Release 90 consists of 225,081 entries, and the
totalnumber of residues reached 80,474,390.
-
- GIB maintenance stop Apr. 23, 2003
- GIB server will be stopped for a machine maintenance.
- From April 26 (Sat) 5:00 pm to April 27 (Sun) 8:00 am
- Thank you very much for your cooperation.
-
- S&W search service reopening Apr. 22, 2003
- We resumed S&W search service.
Thank you very much for your understanding and cooperation.
-
- Submission for TPA and WGS Apr. 21,2003
- DDBJ started to accept TPA (Third Party Annotation) and WGS (Whole
Genome Shotgun) submission.
Please refer here for more information.
-
- S&W search service temporary down Apr. 21, 2003
- S&W search service is suspended temporarily because of the server
trouble. The service will be resumed in a few days. Thank you very
much for yourunderstanding and cooperation.
-
- SWISS-PROT Rel. 41 was released Apr. 21, 2003
- SWISS-PROT Rel. 41 was released on Apr. 21, 2003 at DDBJ.
SWISS-PROT Rel. 41 consists of 122,564 entries,
and the total number of residues reached 44,986,459.
-
- Data were added to GIB Apr. 21, 2003
- GIB (Genome Information Broker)
provides an integrated search of Bacteria, Archaea, Eukaryota complete
microbial genome sequences. Because the genome sequence data of
Coxiella burnetii RSA 493,
Streptomyces avermitilis MA-4680,
Chlamydophila caviae GPIC
and Bacillus cereus ATCC 14579 were
released, we incorporated them to GIB, and now you can search those data.
- - References(Institutes):
- - Coxiella burnetii RSA 493(TIGR):
Complete Genome Sequence of the Q-fever Pathogen, Coxiella burnetii, Proc.
Natl. Acad. Sci. U.S.A. (2003) In press
- - Streptomyces avermitilis MA-4680(Kitasato University, NITE):
Complete Genome Sequence and Comparative Analysis of the Industrial
Microorganism Streptomyces avermitilis, Nat. Biotechnol. (2003) In press
- Genome sequence of an industrial microorganism
Streptomyces avermitilis: Deducing the ability of producing secondary
metabolites, Proc. Natl. Acad. Sci. U.S.A. 98, 12215-12220 (2001)
- - Chlamydophila caviae GPIC(TIGR):
Genome sequence of Chlamydophila caviae (Chlamydia psittaci GPIC): examining
the role of niche-specific genes in the evolution of the Chlamydiaceae,
Nucleic Acids Res. 31 (8), 2134-2147 (2003)
- - Bacillus cereus ATCC 14579(Integrated Genomics Inc.):
Genome sequence of Bacillus cereus ATCC 14579 and comparison with Bacillus
anthracis, Nature (2003) In press
- The number of ribosomal RNA operons in Bacillus
cereus, Unpublished
-
- Human genome (Build 32, "finished" sequences) download page was released Apr. 18, 2003
- Human genome
(Build 32, "finished" sequences)
download page was released.
-
- International Consortium Completes Human Genome Project Apr. 15, 2003
- The announcement for completion of Human Genome Project was made
by 6 countries on Apr. 14.
- For details, please see here.
-
- Updates of "Conference on information biology" Apl. 15, 2003
- Following conferences were added to "Conference on information biology".
-
- SAKURA server temporarily down Apr.14, 2003
- SAKURA service will be unavailable during the following date
because ofthe maintenance. Thank you very much for your understanding
and cooperation.
- Apr. 20 (SUN) 22:00-23:00 (Japanese Standard Time)
-
- DAD rel. 23 was released Apr. 4th, 2003
- DDBJ amino acid database (DAD) Release 23 was released on Apr. 4th, 2003
at DDBJ. DAD Release 23 consists of 1,324,437 entries,
and the total number of residues reached 410,343,359.
-
- Supernig periodic maintenance Apr. 3, 2003
- Supernig service will be unavailable during the following date because
of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Apr. 10 (Thu) 10:00- 18:00
-
- Data were added to GIB Apr. 3, 2003
- GIB (Genome Information Broker
forMicrobial Genomes) provides a comprehensive view of the complete
microbial genome sequences.
Because the genome sequence data of Bacteroides thetaiotaomicron VPI-5482
and Enterococcus faecalis V583 were
released, we incorporated them to GIB, and now you can search those data.
- Bacteroides thetaiotaomicron VPI-5482(by Washington University
School of Medicine): A Genomic View of the Human-Bacteroides thetaiotaomicron
Symbiosis,
Science 299 (5615), 2074-2076 (2003)
- Enterococcus faecalis V583(by TIGR): Role of Mobile DNA in
the Evolution of Vancomycin-Resistant Enterococcus faecalis, Science 299 (5615),
2071-2074 (2003)
-
- Salmonella enterica subsp. enterica serovar Typhi Ty2 was added to GIB Mar. 27, 2003
- GIB (Genome Information Broker
forMicrobial Genomes) provides a comprehensive view of the complete
microbialgenome sequences.
Because the genome sequence data of Salmonella enterica subsp. enterica
serovar Typhi Ty2 was released,
we incorporated it to GIB, and now you can search those data.
- Institute: University of Wisconsin
- Reference: Comparative genomics of Salmonella enterica
serovar Typhi strains Ty2 and CT18, J. Bacteriol. 185 (7), 2330-2337
(2003)
-
- NIG Network service temporary down Mar. 27, 2003
- NIG (National Institute of Genetics) network service will be
unavailable at the following schedule because of the network maintenance.
- DDBJ network service and NIG supercomputer (supernig and minerva)
service will also be unavailable.
- Thank you very much for your understanding and cooperation.
- Apr. 2(WED), 2003 18:00 - 20:00
-
- DDBJ Rel. 53 Completed Mar. 24, 2003
- The nucleotide sequence database collected and maintained by DDBJ
is quarterly released online to the public.
We completed DDBJ Release 53 in March 24, 2003.
DDBJ Release 53 consists of 23,250,813 entries, and the number of bases
reached 29,711,299,332.
-
- GIB display was changed Mar. 17, 2003
- GIB (Genome Information Broker
forMicrobial Genomes) provides a comprehensive view of the complete
microbialgenome sequences.
DDBJ changed display of the top page. Main points of this change are as
follows:
- Because more than 100 genome informations are provided, rough
taxonomy levels could be selected at the GIB top page
- Categories of genes functions could be shown at chromosome maps
of each genomes.
-
- FTP download site was opened Mar. 14, 2003
- FTP download site of DDBJ can be used for download of DDBJ
periodical release and daily updated data. But present site is
incovenient for users. DDBJ newly added
FTP download site
(Anonymous FTP of the DDBJ) in DDBJ web pages. In this site,
file size of data are reduced so that downloading can be made easily.
-
- Recovery of the DDBJ web pages Mar.13, 2003
- Due to an accident of the WWW server, DDBJ web pages other than
SAKURA and search and analyses service pages could not be accessed
from the morning to 6 pm on March 12. They were recovered on the same
day and now you can access all pages as usual.
- We apologize for your inconvenience and appreciate for your understanding.
-
- Pseudomonas syringae pv. tomato str. DC3000 was added to GIB Mar. 11, 2003
- GIB (Genome Information Broker
forMicrobial Genomes) provides a comprehensive view of the complete
microbial genome sequences.
Because the genome sequence data of Pseudomonas syringae pv. tomato str.
DC3000 was released,
we incorporated it to GIB, and now you can search those data.
- Institute: Cornell University
- Reference: Complete Sequence of Pseudomonas syringae,
Unpublished
-
- Over three billion bases released !Mar. 7, 2003
- DDBJ construct nucleotide sequence database in accordance with the
international rule among DDBJ/EMBL/GenBank. This database is updated everyday.
The total number of released bases reached three billion on Mar. 7.
- - As of Mar. 7, 2003
- The total number of released bases 30,019,841,567 (23,259,781 entries)
-
- Data were added to GIB Mar. 6, 2003
- GIB (Genome Information Broker
for Microbial Genomes) provides a comprehensive view of the complete
microbial genome sequences.
Because the genome sequence data of Streptococcus pyogenes SSI-1
and Vibrio parahaemolyticus O3:K6 RIMD 2210633
were released, we incorporated it to GIB, and now you can search those data.
- References (Institutes):
- Streptococcus pyogenes SSI-1 (GIRC): The genome of
invasive Streptococcus pyogenes; a comparative analysis of S. pyogenes
SSI-1, SF370 and MGAS8232., Unpublished (2002)
- Vibrio parahaemolyticus O3:K6 RIMD 2210633 (GIRC):
A filamentous phage associated with recent pandemic Vibrio
parahaemolyticus O3:K6 strains, J. Clin. Microbiol. 38, 2156-2161
(2000)
Genome sequence of Vibrio parahaemolyticus: a pathogenic mechanism
distinct from that of V cholerae, Lancet 361, 743-749 (2003)
-
- Scheduled stop of the GIB server Mar. 4, 2003
- GIB server will be stopped for a version-up
- from: March 14 (Fri) 5:00 pm
- to: March 17 (Mon) 8:00 am
- Thank you very much for your cooperation.
-
- Data were added to GIB Feb. 27, 2003
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
Because the genome sequence data of Lactobacillus plantarum WCFS1,
Tropheryma whipplei TW08/27 and Tropheryma whipplei str. Twist
were released, we incorporated it to GIB, and now you can search those data.
- References (Institutes):
- Lactobacillus plantarum WCFS1 (WCFS): Complete genome
sequence of Lactobacillus plantarum WCFS1, Online Publication.
- Tropheryma whipplei TW08/27 (The Sanger Centre): Sequencing
and analysis of the genome of the Whipple's disease bacterium Tropheryma
whipplei, Lancet 361, 627-634(2003).
- Tropheryma whipplei str. Twist (Universite de la
Mediterranee): Tropheryma whipplei illustrates the diversity of gene loss
patterns in small genome bacterial pathogens, Unpublished
-
- Updates of "Conference on information biology" Feb. 19, 2003
- Following conferences were added to "Conference on information biology".
-
- Xylella fastidiosa Temecula1 and Clostridium tetani Massachusetts E88 were added to GIB Feb. 12, 2003
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
Because the genome sequence data of Xylella fastidiosa Temecula1 and
Clostridium tetani Massachusetts E88 were released, we incorporated
it to GIB, and now you can search those data.
- Xylella fastidiosa Temecula1
- Institute: AEG Brazilian Consortium
- Reference: Comparative Analyses of the Complete Genome Sequences of
Pierce's Disease and Citrus Variegated Chlorosis Strains of Xylella fastidiosa,
J. Bacteriol. 185 (3), 1018-1026 (2003)
- Clostridium tetani Massachusetts E88
- Institute: Goettingen Genomics Laboratory
- Reference: The genome sequence of Clostridium tetani, the causative
agent of tetanus disease, Proc. Natl. Acad. Sci. U.S.A. 100 (3) (2003)
In press
-
- NIG Network service temporary down Feb. 10, 2003
- NIG (National Institute of Genetics) network service will be unavailable
at the following schedule because of the network maintenance.
- DDBJ network service and NIG supercomputer (supernig and minerva) service
will also be unavailable.
- Thank you very much for your understanding and cooperation.
- Feb. 17(MON), 2003 18:00 - 20:00
-
- Updates of "Conference on information biology" Feb. 5, 2003
- Following conferences were added to "Conference on information biology".
-
- PRF Rel. 89 was released Jan. 30, 2003
- PRF (Protein Research Foundation)/SEQ database Release 89 was released on
Jan. 29 at DDBJ. PRF Release 89 consists of 216,752 entries, and the total
number of residues reached 77,655,726.
-
- Buchnera aphidicola (Baizongia pistaciae) was added to GIB Jan. 29, 2003
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences. Because the genome sequence data of
Buchnera aphidicola (Baizongia pistaciae) was released,
we incorporated it to GIB, and now you can search those data.
- Institute: CNB
- Reference: Reductive genome evolution in Buchnera aphidicola,
Proc. Natl. Acad. Sci. U.S.A. 100 (2), 581-586 (2003)
-
- PIR rel. 75 was released Jan. 24, 2003
- PIR rel. 75 was released on Jan. 24, 3003 at DDBJ.
PIR rel. 75 consists of 283,268 entries, and the total number of residues
reached 96,152,078 aa.
-
- DAD rel. 22 was released Jan. 20, 2003
- DDBJ amino acid database (DAD) Release 22 was released on Jan. 20, 2003
at DDBJ. DAD Release 22 consists of 1,218,918 entries, and the total number
of residues reached 376,251,148.
-
- Supernig periodic maintenance Jan. 10, 2003
- Supernig service will be unavailable during the following date because
of the periodic maintenance.
Thank you very much for your understanding and cooperation.
- Jan. 17(Fri) 10:00-21:00
-
- NIG Network service temporary down Jan. 10, 2003
- NIG (National Institute of Genetics) network service will be
unavailable at the following schedule because of the network
maintenance.
- DDBJ network service and NIG supercomputer (supernig and
minerva) service will also be unavailable.
- Thank you very much for your understanding and cooperation.
- Jan. 15(WED), 2003 18:00 - 19:00
-
- Staphylococcus epidermidis ATCC 12228 was added to GIB Jan. 6, 2003
- GIB (Genome Information Broker for
Microbial Genomes) provides a comprehensive view of the complete microbial
genome sequences.
Because the genome sequence data of Staphylococcus epidermidis ATCC 12228
was released, we incorporated it to GIB, and now you can search those data.
- Institute: Chinese National Human Genome Center at Shanghai
-
-
- Current What's New
-
What's New past
-
| 2006 |
| 2005 |
2004 |
2003 |
2002 |
2001 |
| 2000 |
1999 |
1998 |
|
