DNA Data Bank of Japan

What's New 2005

Japanese
Search for
Site Map
about DDBJ
Data Submission
SAKURA
        Mass Sub
Data Updates
Search and Analysis
ARSA   getentry
TXSearch  
FASTA   BLAST
SSEARCH
 		  HMMPFAM
ClustalW
  
WebAPI
 		 
GIB
 		  GIB-V
GTPS
   GTOP
Breakdown Stats
Download data
  DDBJ Release Note
  Release Information
Q and A
Dorrs for Infomation Bioligy
  Conference on Info Bio

 Contact Us  
Copyright © 1995-2006
DDBJ All rights reserved.
DDBJ Rel. 64 Completed Dec. 28, 2005
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public. We completed DDBJ Release 64 in Dec. 28, 2005. DDBJ Release 64 consists of 52,272,669 entries, and the number of bases reached 56,098,558,378.
In the present release, some of index files (ddbjacc.idx, ddbjjou.idx, and ddbjkey.idx) are greater than 2 GB in the file size. For details, please refer to Release note
FTP site for periodical release and new data download
 
PRI division data were misclassified as HUM in release 63 Dec. 28, 2005
The 37 PRI entries (see the list) were included in the HUM division of DDBJ previous release 63 by our mistake. Details are as follows.
Corresponding release DDBJ release 63 (September 2005)
Relevant Accession numbers See the list
Measures: These 37 entries are correctly included in the PRI division of DDBJ release 64 (December 2005) On the getentry and anonymous FTP, the corrected entries have already been available.
Affected DDBJ services and period: All services including the following services
- getentry (eearly October, 2005 - 2005/12/28)
- Anonymous FTP (2005/9/30 - 2005/12/28)
- SRS, ARSA, Homology Search services (early October, 2005 - mid-January, 2006 *)
*Please note that some services will be affected by this trouble even after release 64 is released, for a short time.
We apologize for our mistake very much.
 
Genome data was added to GIB Dec. 26, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Salinibacter ruber DSM 13855 was released by TIGR, we incorporated it to GIB, and now you can search those data.
 
ARSA service down for 10 days Dec. 22, 2005
ARSA (All-round Retrieval of Sequence and Annotation) is the keyword search system provided by DDBJ under trial operation.
Because of the system upgrade, ARSA service will be unavailable at the following schedule. During this period, SRS and getentry will be helpful to you instead of ARSA.
After this upgrade, ARSA can be provided 24 hours without break.
Unavailable period: Jan. 10 (Tue), 2006 9:00 - Jan. 19 (Thu) 9:00 (JST)
Thank you very much for your understanding and cooperation on such short notice.
 
Genome data was added to GIB Dec. 19, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Burkholderia thailandensis E264 was released by TIGR, we incorporated it to GIB, and now you can search those data.
 
Genome data were added to GIB Dec. 16, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Rhodospirillum rubrum ATCC 11170, Moorella thermoacetica ATCC 39073 (by JGI) and Hahella chejuensis KCTC 2396 (by Korea Research Institute of Bioscience and Biotechnology) were released, we incorporated them to GIB, and now you can search those data.
 
The Rice Annotation Project Database (RAP-DB) Dec.15, 2005
The RAP-DB, database for highly curated rice annotations was developed and opened to the public by Natioanal Institute of Agrobiological Sciences, National Institute of Advanced Industrial Science and Technology, and National Institute of Genetics.
The Rice genome (Oryza sativa ssp. japonica cultivar Nipponbare) was completely sequenced by the IRGSP (International Rice Genome Sequencing Project), in December 2004, and Japan has been taking a leading role of this project. Now rice researchers are in new paradigm, namely "post-genome" (IRGSP, Nature. 2005 Aug 11;436 (7052):793 - 800 ).
With the completion of the rice genome sequencing, an annotation project has been promoted with the aim of annotating and manually curating all the genes in the rice genome, gathering numbers of rice researchers and annotators from all over the world (Itoh et al., manuscript in preparation).
The Rice Annotation Project Database (RAP-DB) is to feedback this invaluable information to the rice research community (Ohyanagi et al., Nucleic Acids Research Database Issue 2006, in press). The RAP-DB has two different types of annotation viewers, search features with keyword or sequence homology. By connecting the annotations to other rice genomics data, such as full-length cDNAs and Tos17 mutant lines, the RAP-DB serves as a "hub" for rice genomics.
All of the resources can be accessed through http://rapdb.lab.nig.ac.jp/.
(References)
 
"Flat file (EMBL)" will be removed from getentry output format options Dec. 15, 2005
getentry is the data retrieval system provided by DDBJ through web and E-mail.
"Flat file (EMBL)" is one of the result output format which is available when "DNA DATABASE" is selected as target database. But, because the decrease of frequency in use, this "Flat file (EMBL)" format will be removed from the options on Jan. 16, 2006.
Please select another format from the options listed below from this out.
DNA DATABASE
- Flat file (DDBJ)
- total nucleotide sequence FASTA
- CDS amino acid sequence FASTA
- CDS nucleotide sequence FASTA
- Quality Value
- DDBJ-XML
- INSD-XML
Protein DATABASE
- amino acid sequence FASTA
- nucleotide sequence FASTA (for DAD)
 
Genome data was added to GIB Dec. 9, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Mycoplasma capricolum subsp. capricolum ATCC 27343 was released by TIGR, we incorporated it to GIB, and now you can search those data.
 
Genome data was added to GIB Dec. 8, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Magnetospirillum magneticum AMB-1 was released by Tokyo University of Agriculture and Technology, we incorporated it to GIB, and now you can search those data.
 
Incomplete release of VRL division data Dec. 7, 2005
The 52 VRL entries were not included in DDBJ periodical releases from 46 to 63 by our mistake.
For the first time, these entries were released as EST data in 2000. Afterwards, they were changed to VRL for some reasons in 2001. After that, they were not included in DDBJ releases as mentioned above.
Details are as follows.
  • Period in which the entries were not included in DDBJ releases
    From DDBJ release 46 (Jul. 2001) to release 63 (Sep. 2005)
  • Relevant Accession numbers
    See the list
  • Measures
    We reported and apologized to the submitters for our mistake. In the forthcoming DDBJ release 64, these 52 entries will be included in the VRL division data.
  • Affected services
    Anonymous FTPs and search/analysis services (exclude getentry*)
    * These entries have been enabled by the getentry since their first release. However, in the mean time, they were provided in an old format.
These 52 entries data are served now.
We apologize for our mistake very much
 
Suspension of the DDBJ activity during the New Year Holidays Dec. 1st, 2005
We at DDBJ will suspend our business for receiving and releasing data during the New Year Holidays from December 29th, 2005 to January 3rd, 2006.
We will resume the normal business on January 4th, 2005.
Please note in particular that SAKURA will stop in operation from December 27th, 2005 to January 4th, 2006 and the new daily update will not be released in the period from December 27th, 2005 to January 4th, 2006.
Thank you very much for your understanding and cooperation.
We wish you happy holidays.
DDBJ activity suspension: from December 29th, 2005 to January 3rd
SAKURA suspension: from December 27th, 2005 to January 4th
data release suspension: from December 27th, 2005 to January 4th
 
Genome data were added to GIB Nov. 30, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Brucella melitensis biovar Abortus (by Oak Ridge National Laboratory) and Staphylococcus aureus RF122 (by University of Minnesota) were released, we incorporated them to GIB, and now you can search those data.
 
Genome data was added to GIB Nov. 29, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Nitrosospira multiformis ATCC 25196 was released by Joint Genome Institute, we incorporated it to GIB, and now you can search those data.
 
"S&W SEARCH" service temporary down Nov. 25, 2005
Because of the maintenance of GeneMatcher Server used for S&W SEARCH service, S&W SEARCH service will be unavailable at the following schedule.
Requests receivved during the suspended time will be performed after the service is resumed.
Thank you very much for your understanding and cooperation on such short notice.
Date and Time: Dec. 5(Mon), 2005 13:00 - Dec. 9(Fri), 18:00 (JST)
 
Incomplete release of WGS data at FTP Nov. 22, 2005
DDBJ releases WGS data at anonymous ftp site.
WGS data were not released from September 8th to November 10th at DDBJ ftp site. We had already added the un-released data, and now all wgs data are available.
We apologize for this very much.
List of released files
 
Genome data were added to GIB Nov. 21, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Shigella boydii Sb227 and Shigella dysenteriae Sd197 (by Microbial Genome Center of Chinese Ministry of Public Health) were released, we incorporated them to GIB, and now you can search those data.
 
INSD-XML formatted periodical release data available at FTP Nov. 17, 2005
The nucleotide sequence database collected and maintained by DDBJ is quarterly released to the public at online anonymous FTP site. DDBJ has provided 4 types (Flat file format, FASTA format, DDBJ-XML format and CDS sequences) data so far.
Additionally, since DDBJ Release62 (June 2005) the INSD-XML formatted periodical release data have been also provided by DDBJ. The INSD-XML formatted data had been available only daily update part since April 29, 2005.
The INSD-XML is one of the DTD (Data Type Definition) commonly used by the International Nucleotide Sequence Database Collaboration (INSDC) which is comprised of DDBJ, EMBL, and GenBank, for their data releases. Although the INSD-XML was released to the public, the INSDC will confirm that there are no problems in the data exchange for all entries, and also will ensure that it is possible to write/read XML documents in a common format. Therefore, in some cases, DTD itself might be changed and/or some changes might be made at the stage of the development from DTD to XML document. The version number is shown in the DTD file.
The anonymous FTP directories and the file names released at DDBJ web pages are as shown below.
Use of the INSD-XML at FTP
URL: ftp://ftp.ddbj.nig.ac.jp/ddbj_database/ddbj/xml/insd/
DTD for the INSD-XML (INSD_INSDSeq.dtd) is located in the same directory.
Use of the INSD-XML at getentry
If you specify "INSD-XML" as output format in DNA database retrieval, you will obtain the data in the INSD-XML format.
DDBJ-XML was designed aiming for the generation of documents making easier computer program manipulation and being also readable by humans. It is based on the concept of "flat file format", which has been widely used so far.
Meanwhile, INSD-XML was designed focusing on Features/qualifiers structure rather than having familiarity with the Flat File format.
Reference
Release of INSD-XML formatted data (Jun. 10, 2005)
The DDBJ release is now available also in XML (Jul. 25, 2001)
DDBJ introduced XML (May 11, 2001)
 
NIG Network service temporary down Nov. 14, 2005
NIG (National Institute of Genetics) network service will be unavailable at the following schedule because of the electric power cut. DDBJ network service and NIG supercomputer (supernig and minerva) service will also be unavailable. Thank you very much for your understanding and cooperation.
From Dec.2 (FRI) 17:00 to Dec.3 (SAT) 22:00 (JST)
SAKURA server From Dec.2 (FRI) 15:00 to Dec.5 (MON) 09:00 (JST)
 
Genome data were added to GIB Nov. 14, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Synechococcus elongatus PCC 7942 and Lactobacillus sakei subsp. sakei 23K (by JGI) were released, we incorporated them to GIB, and now you can search those data.
 
A new "Graphical View" function was added to the web BLAST search program Nov. 9, 2005
BLAST search services are provided by DDBJ via a web and e-mail server. Since November 1, a new "Graphical View" (optional) function was incorporated to the web version of the BLAST search program.
As default setting the check box of the "Graphical View" is selected to display the results of the homology search. The top bar in blue represents the query sequence whose length is shown by a scale. Colored arrows indicate regions and directions of sequences matched to the query sequence. By clicking these arrows, you can jump to the respective alignments.
Furthermore, you can easily transfer sequences to CLUSTALW analysis by checking the boxes on the left side of each arrow, and then click "CLUSTALW SETUP". Alternatively, if you do not use the "Graphical View" option, select sequences for "CLUSTALW" test by using the "Select Sequences" menu of the result page.
clustalw Graphical View image
 
Genome data were added to GIB Nov. 7, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Prochlorococcus marinus MIT 9312 and Thiomicrospira denitrificans ATCC 33889 (by JGI) were released, we incorporated them to GIB, and now you can search those data.
 
"S&W SEARCH" service temporary down Nov. 4, 2005
Because of the maintenance of GeneMatcher Server used for S&W SEARCH service, S&W SEARCH service will be unavailable at the following schedule. Thank you very much for your understanding and cooperation on such short notice.
  • Date and Time: Nov. 7(Mon), 2005 13:00 - 18:00 (JST)
    Unavailable services: Homology search and analysis services (S&W SEARCH)
    (Requests receivved during the suspended time will be performed after the service is resumed.)
 
Genome data was added to GIB Nov. 2nd, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Thiomicrospira crunogena XCL-2 was released by JGI, we incorporated it to GIB, and now you can search those data.
 
Version-up of BLAST Nov. 1st, 2005
BLAST of DDBJ search service provided through web and e-mail was updated today.
BLAST, PSI-BLAST Version number: 2.2.6 -> 2.2.12
 
Genome data were added to GIB Nov. 1st, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Geobacter metallireducens GS-15 and Desulfovibrio desulfuricans G20 (by JGI) were released, we incorporated them to GIB, and now you can search those data.
 
DDBJ mail magazine site was released Oct. 31, 2005
DDBJ mail magazine site was released. This site covers information about novel services and latest news.
 
Genome data was added to GIB Oct. 31, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Synechococcus sp. CC9605 was released by JGI, we incorporated it to GIB, and now you can search those data.
 
Data were added to GIB Oct. 28, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Pelodictyon luteolum DSM 273, Synechococcus sp. CC9902 and Chlorobium chlorochromatii CaD3 (by JGI) were released, we incorporated them to GIB, and now you can search those data.
 
DDBJ network services temporary down (today! Oct. 27, 13:00-13:30) Oct. 27, 2005
The following services will be unavailable today because of the maintenance. Thank you very much for your understanding and cooperation.
Oct 27, 13:00-13:30 (JST)
[FTP, getentry, SRS, ARSA, BLAST, FASTA, SSEARCH, ClustalW, malign]
 
Update of "Conference on Information Biology" Oct. 27, 2005
Following conferences were added to "Conference on Information Biology"
 
Data were added to GIB Oct. 26, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Burkholderia sp. 383 (by JGI), Carboxydothermus hydrogenoformans Z-2901 (by TIGR), Pelobacter carbinolicus DSM 2380 (by JGI) and Xanthomonas campestris pv. vesicatoria 85-10 (by Institut fuer genetik) were released, we incorporated them to GIB, and now you can search those data.
 
PRF Rel. 105 was released Oct. 25, 2005
PRF (Protein Research Foundation)/SEQ database Release 105 was released on Oct. 24, 2005 at DDBJ. PRF Release 105 consists of 459,765 entries, and the total number of residues reached 164,147,981.
 
Update of "Conference on Information Biology" Oct. 21, 2005
Following conferences were added to "Conference on Information Biology"
 
DAD rel. 33 was released Oct. 19, 2005
DDBJ amino acid database (DAD) Release 33 was released on Oct. 19, 2005 at DDBJ. DAD Release 33 consists of 2,587,809 entries, and the total number of residues reached 794,393,760.
FTP site for DB download
 
Statistics [Top 30 organisms according to the total number of nucleotides] Update 2005.10.13
Top 30 organisms according to the total number of nucleotides (-DDBJ rel.63) in Breakdown statistics was updated with releasing DDBJ rel.63. Pinus taeda (loblolly pine) was newly ranked in Top 30. Click the organismname to view the graph of change.
 
Public collections of DNA and RNA sequence reach 100 gigabases Oct. 4, 2005
The world's three leading public repositories for DNA and RNA sequence information have reached 100 gigabases (100,000,000,000 bases; the 'letters' of the genetic code) of sequence. Thanks to their data exchange policy, which has paved the way for the global exchange of many types of biological information, the three members of the International Nucleotide Sequence Database Collaboration (INSDC, www.insdc.org), EMBL-Bank (Hinxton, UK), GenBank (Bethesda, USA) and the DNA Data Bank of Japan (Mishima, Japan) all reached this milestone together.
Takashi Gojobori, Director of the Center for Information Biology and DNA Data Bank of Japan, says: "The INSDC has laid the foundations for the exchange of many types of biological information: as we enter the era of systems biology and researchers begin to exchange complex types of information such as the results of experiments that measure the activities of thousands of genes, or computational models of entire processes, it is important to celebrate the achievements of the three databases that pioneered the open exchange of biological information."
Graham Cameron, Associate Director of EMBL's European Bioinformatics Institute, says "This is an important milestone in the history of the nucleotide sequence databases; From the first EMBL Data Library entry made available in 1982 to today's provision of over 55 million sequence entries from at least 200,000 different organisms, these resources have anticipated the needs of molecular biologists and addressed them - often in the face of a serious lack of resources."
David Lipman, Director of the National Center for Biotechnology Information, adds: "Today's nucleotide sequence databases allow researchers to share completed genomes, the genetic make-up of entire ecosystems, and sequences associated with patents. The INSDC has realized the vision of the researchers who initiated the sequence database projects, by making the global sharing of nucleotide sequence information possible."
EMBL-Bank and GenBank had started International Nucleotide Sequence Database activities in 1980, and DNA Data Bank of Japan (DDBJ) had joined in its activities as a third collaborative partner in 1987. DDBJ has received data submission from all the countries of the world, mainly from Japan. By exchanging the collected data with another 2 databanks, DDBJ has contributed to the development of International Nucleotide Sequence Database collaboration.
For details of DDBJ, please refer to http://www.ddbj.nig.ac.jp/.
 
Chimpanzee Genome sequencing completed Oct. 4, 2005
Draft sequence of the chimpanzee genome was analyzed by the Chimpanzee Sequencing and Analysis Consortium, and published in Nature. 2005 Sep 1;437(7055):69-87.
Chimpanzee is the humankind's closest living relative. Comparison of the genomes between human and chimpanzee will assist understanding human specific functions and the mechanism of evolution from primates to human.
The data was submitted to DDBJ/EMBL/GenBank International Nucleotide Sequence Databases as whole genome shotgun (WGS) sequences data which is available via DDBJ getentry system. Or the data is also available by downloading from anonymous ftp of the DDBJ" page or WGS ftp site (AACZ.gz, AADA.gz).
Chimpanzee chromosome 22 DNA sequencing had already been completed by The International Chimpanzee Chromosome 22 Consortium in last May, and the result was published in Nature.
 
Rice Genome analysis completed Oct. 4, 2005
The Rice genome (Oryza sativa L. ssp. japonica cv. Nipponbare) has been sequenced by the IRGSP (International Rice Genome Sequencing Project), in December 2004, and Japan has been taking a leading role of this project.
Recently, a detailed analysis of the high-quality sequence of the rice genome was featured in Nature 2005 Aug 11;436(7052):793-800.
According to National Institute of Agrobiological Sciences (NIAS) and the Institute of the Society for Techno-innovation of Agriculture, Forestry and Fisheries (STAFF), a total of 37,544 genes were identified. About 71% of these genes are similar to genes found in Arabidopsis, a model experimental dicotyledonous plant, which has been completely sequenced in the year 2000. A total of 2,859 genes (c.a. 8%) did not have homologies with those of Arabidopsis. These genes may be rice-specific or monocot-specific.
The data was submitted to DDBJ/EMBL/GenBank International Nucleotide Sequence Databases and was released under the Accession numbers AP008207 - AP008218. The sequence information is available via DDBJ getentry system. Drs. Takashi Gojobori (Director of CIB-DDBJ) and Hisakazu Iwama (formerly belonged to DDBJ until 2004.10, current affiliation is Associate Professor of Kagawa University) participated in International Rice Genome Sequencing Project, in charge of Annotation and Analysis.
(References)
 
Release of transcript sequences derived from human and mouse with a huge scale Oct. 3rd, 2005
The FANTOM Consortium, which is led by the Institute of Physical and Chemical Research of Japan, has comprehensively studied the mouse genome and transcriptome. On September 2, they published two papers in Science about the integrative analysis of human and mouse transcripts (Science. 2005 Sep;309:1559-63.; Science. 2005 Sep;309:1564-66.).
In these papers, they reported the finding of many protein-coding and non-protein coding transcripts in both mouse and human. They suggested that these non-protein coding RNAs (ncRNAs) regulate the expression of normal transcripts encoding proteins and provide important information associated with the gene expression control mechanism in mammals.
Professor T. Gojobori (Head of Center for Information Biology and DNA Data Bank of Japan; CIB-DDBJ), Associate professor K. Ikeo and their colleagues participated in the FANTOM Consortium from CIB-DDBJ. They are co-authors of the papers mentioned above. In addition, the activities of the Genome Network Project are also related to this project.
Approximately 2,000,000 million EST (expressed sequence tag), about 110,000 HTC (high throughput cDNA sequence), and 8,800,000 MGA (Mass sequence for genome annotation) entries, which were referred to these papers have been already registered and released from DDBJ. All of the data can be retrieved, displayed and acquired by using the DDBJ retrieval tool, getentry.
Reference
- Press release on RIKEN site (Japanese Only)
- FANTOM Database
- The list of accession number assigned to sequences used in the research; cite fro web site of Genome Exploration Research Group, Genome Sciences Center, RIKEN
 
DDBJ Rel. 63 Completed Sep. 30, 2005
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public. We completed DDBJ Release 63 in Sep, 30, 2005. DDBJ Release 63 consists of 47,741,593 entries, and the number of bases reached 52,246,110,341.
FTP site for periodical release and new data download
 
Termination of SF gate-WAIS and malign service Sep. 30, 2005
SF gate-WAIS and malign service were terminated on September 30. As a service of data retrieval by key words provided by DDBJ, "ARSA" and "SRS" are available. As a service of multiple alignment, "ClustalW" is available.
Thank you very much for your understanding and cooperation.
 
New release of statistics Sep. 20, 2005
Three kind of statistics were added to "Breakdown statistics" page.
Content of each DDBJ division
Geographical distribution of submitters to INSDC
Trends in data submission
 
Macaca fascicularis cDNA database (QFbase) Sep. 16, 2005
Cynomolgus monkeys (Macaca fascicularis) are common laboratory animals widely used for medical and pharmaceutical researches. Macaca fascicularis cDNA database (QFbase) was constructed by JCRB Genebank, National Institute of Biomedical Innovation, Japan, under collaborative research with Laboratory for DNA Data Analysis, CIB-DDBJ, National Institute of Genetics, Japan; Division of Genetic Diagnosis, Institite of Medical Sciences and Department of Medical Genome Sciences, University of Tokyo, Japan.
The database provides about 85,000 5' or 3' EST sequences of cynomolgus monkey cDNA libraries derived from the brain, liver, and testis. About 4,000 full-length cDNA sequences are also included in the database and 1,700 of them contain the information for human-macaque difference in the protein coding region.
Accession numbers released from DDBJ are BB873801 - BB894695 (20895 entries, 3'EST) and CJ430287 - CJ493524 (63238 entries, 5'EST). These entries can be retrievable via DDBJ getentry system.
The cDNA clones are ready to be provided though Human Science Research Resource Bank (HSRRB) for further functinal experiments.
All data are available at http://genebank.nibio.go.jp/gbank/index_e.html.
This "QFbase" is also intorduced at Link to DDBJ/CIB web pages on Information Biology and Link to Other web pages on Information Biology: Databases for Other Mammals pages. For your reference, please see these pages, too.
 
Minerva periodic maintenance Sep. 9, 2005
Minerva service will be unavailable during the following date because of the periodic maintenance. Thank you very much for your understanding and cooperation.
Sep. 16 (Fri) 12:00- 21:00
 
Change the format of a Variable record of MGA data Sep. 5, 2005
The format of the Variable record of MGA (Mass sequence for Genome Annotation) data was slightly changed as the International Nucleotide Sequence Database Collaboration Meeting in 2005. The modification is to remove "//" line which is inserted between two consecutive entries in the Variable record. We appreciate your paying attention to the change.
Old format
>ZZZZZ0000001|ABC1004AA60F1902|10|9B|lipidosis-related protein Lipidosin| MGI:2385656|
gactgtcttcggtgaatgca
//
>ZZZZZ0000002|ABC1003AE78G1607|5||||
gcggaagtcggaccggtcgca
//
>ZZZZZ0000003|ABC1003AE72P1806|6||||
gggagaccgatccgggatct
//
(Skip the rest)
 
New format
>ZZZZZ0000001|ABC1004AA60F1902|10|9B|lipidosis-related protein Lipidosin| MGI:2385656|
gactgtcttcggtgaatgca
>ZZZZZ0000002|ABC1003AE78G1607|5||||
gcggaagtcggaccggtcgca
>ZZZZZ0000003|ABC1003AE72P1806|6||||
gggagaccgatccgggatct
(Skip the rest)
 
Update of databases related to the H-Invitational Aug. 31, 2005
The content of two databases related to the H-Invitational was updated today. The main content of the update is the following.
  1. The number of cDNA entry has increased 56,419 from 41,118.
  2. The number of LOCUS entry has increased 25,585 from 21,037.
  3. Version of mirror H-Invitational Database (H-InvDB) become "2.0".
Databases related to the H-Invitational
- H-Invitational Database CIB-DDBJ Flat File Server
- Mirror H-Invitational Database(H-InvDB)
 
Update of "Conference on Information Biology" Aug. 25, 2005
Following conferences were added to "Conference on Information Biology"
2006
 
DDBJ services temporary down Aug. 23, 2005
DDBJ network services were suspended temporarily from 23:43 Aug. 22nd to 02:53 23rd because of the electric power cut by lightning damage. All services are resumed now. We apologize for the inconvenience and thank you for your understanding.
getentry, SRS, SF-gateWais, SQmatch, Homology search, CAMUS, Anonymous-FTP, Txsearch, ClustalW, malign, PDB Retriever, SSthread, LIBRA-I, Lib score, SAKURA, Vector Screening
 
New release INSDC site Aug. 23, 2005
The International Nucleotide Sequence Databases Collaboration (INSDC) site was released.
 
PRF Rel. 104 was released Aug. 18, 2005
PRF (Protein Research Foundation)/SEQ database Release 10? was released on Aug. 18, 2005 at DDBJ. PRF Release 104 consists of 422,024 entries, and the total number of residues reached 148,110,105.
 
Update of "Conference on Information Biology" Aug. 11, 2005
Following conferences were added to "Conference on Information Biology"
  - 2005
  - 2006
 
DDBJ release 62.0 revised as 62.1 Aug. 4, 2005
Duplication of the AE006470 was found in the DDBJ release 62.0 (released on June 2005).
Nature of inconsistency: The entry AE006470 was found in both BCT and CON divisions.
Measures implemented: The AE006470 in the BCT division is the latest one, so we removed the old AE006470 in the CON division and released again on August 4, 2005.
Corrected file: ddbjcon.seq
We DDBJ regret our mistake.
FTP site for periodical release and new data download
 
DAD rel. 32 was released Jul. 26, 2005
DDBJ amino acid database (DAD) Release32 was released on Jul. 26, 2005 at DDBJ. DAD Release consists of 2,429,195 entries, and the total number of residues reached 745,907,868 aa.
FTP site for DB download
 
International bioinformatics training course in Taiwan Jul. 21, 2005
Two international training courses were given in Taiwan at Yang-Ming University in Taipei (July 6-8) and the National Health Research Institute (NHRI) in Hsin Chu (July 11-12) by three Professors from DDBJ.
Prof. Yoshio Tateno gave lectures on Molecular Evolution, Prof. Naruya Saitou taught students about Molecular Phylogeny and Dr. Roberto Barrero introduced the services and tools available at DDBJ, with special emphasis in using the SAKURA nucleotide sequence data submission system, sequence retrieval systems (getentry, ARSA and SRS), GTOP and H-Inv DB. The number of attendees to the theoretical lectures were about 20-25 people, while for the practical sessions 10-15 people took part.
A new invitation by local researchers was extended to DDBJ professors to make another International Training Course in the near future.
Yan Min Univ NHRI
 
Statistics [Top 30 organisms according to the total number of nucleotides] Update Jul. 21, 2005
Top 30 organisms according to the total number of nucleotides in DDBJ statistics was updated with releasing DDBJ Rel. 62. Branchiostoma floridae (lancelet) ranked in 29th, it was 124th at previous release. Click the organism name to view the graph of change.
 
Supernig periodic maintenance Jul. 15, 2005
Supernig service will be unavailable during the following date because of the periodic maintenance. Thank you very much for your understanding and cooperation.
Jul. 22(Fri) 12:00- 21:00 JST
 
"getentry web version" interface was modified Jul.14, 2005
getentry is the data retrieval system provided by DDBJ through web and E-mail. The interface of "getentry web version" was modified in Jul. 14, as follows. Functions does not change.
Upper frame
- search box to enter the key number was changed as follows.
    location: bottom -> top
    name: Number -> ID
- English /Japanese link switch was added
Lower frame
- Table of "Type of ID treated in each database" was updated
- Terms were standardized
 
Update of "Conference on Information Biology" Jul. 14, 2005
Following conferences were added to "Conference on Information Biology"
 
Update of "Conference on Information Biology" Jul. 13, 2005
Following conferences were added to "Conference on Information Biology"
 
DDBJ Rel. 62 Completed Jun. 30, 2005
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public. We completed DDBJ Release 62 in Jun. 30, 2005. DDBJ Release 62 consists of 45,249,444 entries, and the number of bases reached 49,158,155,283. Env division started from this release.
FTP site for periodical release and new data download
 
Creation of the ENV division Jun. 14, 2005
Recently, the submissions of the sequences derived from environmental samples have rapidly been increased. To accommodate such submissions, a new division, ENV, has been created.
This division contains the sequences obtained via direct molecular isolation such as PCR, DGGE, or any anonymous method. In the past, the sequences derived from environmental samples belonged to taxonomic divisions, mainly BCT. At DDBJ, the retrofit to transfer relevant entries from taxonomic divisions to the ENV division starts in the periodical release 62 (Jun, 2005), and ends by the periodical release 63 (Sep, 2005). Please note that, during this transitional period, some entries to be placed in the ENV division will be found in other divisions.
 
Release of INSD-XML formatted data Jun. 10, 2005
DDBJ has provided the XML formatted data (DDBJ-XML*) at its anonymous FTP site and its sequence retrieval getentry system since 2001. Additionally, since April 29 of this year, INSD-XML formatted data have been also provided by DDBJ, although as a trial**. INSD-XML is one of the DTD (Data Type Definition), which is commonly used by the International Nucleotide Sequence Databases (INSD) being comprised by DDBJ, EMBL, and GenBank, for their data releases.
* DDBJ-XML was designed aiming for the generation of documents making easier computer program manipulation and being also readable by humans. It is based on the concept of "flat file format", which has been widely used so far. Meanwhile, INSD-XML was designed focusing on Features/qualifiers structure rather than having familiarity with the Flat File format.
** Although INSD-XML was released to the public, the INSD Collaborative (INSDC) databases will confirm that there are no problems regarding the data exchange for all entries, and also will ensure that it is possible to write/read XML documents in a common format within one year. Therefore, in some cases, DTD itself might be changed and/or some changes might be done at the stage of the development from DTD to XML document. Anonymous FTP directories and file names released at DDBJ web pages are as shown below. At the present stage, available data from the anonymous FTP site is only daily updated for new data. Periodical release data will appear on next DDBJ release 62 (June, 2005).
Use of INSD-XML at FTP
URL : ftp.ddbj.nig.ac.jp/database/ddbjnew/xml/insd/
File name : DDBJNEWr##.XXX.insd_xml.gz (e.g. DDBJNEWr61.062.insd_xml.gz)
(## release number, XXX serial number)
  Release number and serial number are the same as daily updated anonymous FTP data.
  TPA and CON data are also released in one file.
  DTD for INSD-XML is INSD_INSDSeq.dtd, which is located in the same directory
USE of INSD-XML at getentry
If you select "INSD-XML" from DNA databases box, you will obtain the data in INSD-XML format.
 
Statistics [Top 30 organisms according to the total number of nucleotides] Jun. 6, 2005
Top 30 organisms according to the total number of nucleotides (- DDBJ rel.61) in DDBJ statistics was updated with releasing DDBJ Rel. 61.
 
Update of "Conference on Information Biology" Jun. 6, 2005
Following conferences were added to "Conference on Information Biology"
 
DDBJ services temporary down Jun. 1, 2005
Accoding to the maintenance of NIG (National Institute of Genetics) network services, some DDBJ network services will also be unavailable at the following schedule. Thank you very much for your understanding and cooperation on such short notice.
Date and Time: June 3(Fri), 2005 18:00 - 19:00 (JST)
Unavailable services:
  - Homology search and analysis services (BLAST, FASTA, ClustalW)
  - Keyword search serviices (getentry, SRS, ARSA)
 
Network trouble May.30, 2005
On the past week-end, following NIG network connection trouble had happend

- Time: May 28 (Sat) around13:08(JST)
- Trouble: disabled network connection to133.39.22.x (connection to the following servers were disabled)
  - servers for researchers
  - homology search servers
  - ClustalW servers
  - file servers、getentry, SRS
  - back-up server
  - ARSA servers
- Recovery: already recovered at May 30 (Mon) 9:15　
We apologize very much for this trouble.
 
DDBJ web services temporary down May 27, 2005
DDBJ web services will be unavailable during the following date because of the NIG newtwork maintenance. Thank you very much for your understanding and cooperation.
Jun. 1st(Wed) 16:00- 17:00 (JST)
 
PRF Rel. 102 was released Apr. 28, 2005
PRF (Protein Research Foundation)/SEQ database Release 108 was released on Apr. 28, 2005 at DDBJ. PRF Release 102 consists of 353,698 entries, and the total number of residues reached 122,820,797.
 
URL change of [Vector Screening System] Apr. 28, 2005
The URL of Vector Screening System had been changed on April 1, 2005. The New URL is as follows.
New: http://vector.ddbj.nig.ac.jp/top-e.html
    Old: http://sakura.ddbj.nig.ac.jp:8080/vector/index.html
Although both new and old URLs had been active so far, the old URL was stopped on April 28, 2005. Therefore, if you still use an old URL, please update your bookmarks and links immediately. This change was caused by the change of the port number from #8080 to the standard port #80. Because of this change, troubles for accessing to Vector Screening System] due to port number setting will be resolved. Thank you very much for your understanding and cooperation.
 
DAD rel. 31 was released Apr. 25, 2005
DDBJ amino acid database (DAD) Release 31 was released on Apr. 25, 2005 at DDBJ. DAD Release consists of 2,309,392 entries, and the total number of residues reached 709,797,357.
FTP site for DB download
 
UniProt (Swiss-Prot) service on DDBJ Apr. 12, 2005
PIR (Protein Information Resource) which had provided protein databases was absorbed by Swiss-Prot. Moreover, Swiss-Prot and TrEMBL were integrated into the UniProt (Universal Protein Resource) on January 1, 2005. Because of this integration, UniProt consists of 2 databases, which are UniProt/Swiss-Prot originating in Swiss-Prot and UniProt/TrEMBL based on TrEMBL.
DDBJ search/analysis services have provided PIR and Swiss-Prot separately. However, according to the above situation, Swiss-Prot will be updated to UniProt/Swiss-Prot on April 15. PIR will be deleted because which had been included in UniProt/Swiss-Prot Additionally, integration of UniProt/TrEMBL to UniProt/Swiss-Prot will be scheduled On June 15.
As a result of these integration, 3 databases will be used as an updated UniProt database.
about UniProt
 
DDBJ Rel. 61 Completed Apr. 6, 2005
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public. We completed DDBJ Release 61 in Apr. 6, 2005. DDBJ Release 61 consists of 43,118,204 entries, and the number of bases reached 47,099,081,750. The style of release note has been changed, dramatically.
FTP site for periodical release and new data download
 
Genome data was added to GIB Apr. 5, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Salmonella enterica subsp. enterica serovar Choleraesuis SC-B67 was released by Chang Gung Genomic Medical Center, we incorporated it to GIB, and now you can search those data.
Reference: The genome sequence of Salmonella enterica serovar Choleraesuis, a highly invasive and resistant zoonotic pathogen, Nucleic Acids Res. 33 (5), 1690-1698 (2005)
 
Integration of ClustalW and ClustalW DDBJ version Apr. 4, 2005
ClustalW is a multiple alignment and tree-making program provided through web and e-mail server by DDBJ.
On the DDBJ web site, ClustalW (ver.1.83) and ClustalW DDBJ version (ver.1.80), which had been providede as separate services (version numbers and available options are different) so far, were integrated on April 4.
According to this integration, options (DOTSINOUTPUT and DISTANCE) available only in ClustalW DDBJ version can be used at the updated version ClustalW. A part of user interface was also improved, and URLs are unified to the current ClustalW URL.
 
Update of "Conference on Information Biology" Apr. 1, 2005
Following conferences were added to "Conference on Information Biology"
 
New release "Notobase"Brachyury-downstream gene database Mar. 29, 2005
Brachyury, T-box domain containing transcription factor, was evolutionary conserved among animals and play an important role in embryonic development. To characterize Brachyury-downstream genes, Brachyury-downstream gene database, "NotoBase" was constructed by Kyoto University, Molecular and Evolutionary Developmental Biology and National Institute of Genetics, Center for Information Biology and DNA Data Bank of Japan. This database contains the annotation information for approximately 500 Brachyury downstream genes isolated by subtraction method. It is able for us to access such information that corresponding EST/cDNA/Genome sequences, more than 3000 pictures of gene expression pattern and homology information with BLAST. It also supports various searching (homology searching for gene expression pattern and keyword searching for the result with the BLAST). In addition, sequences of the Brachyury-downstream genes can be available from "Download" site.
   - NotoBase: http://ciona.lab.nig.ac.jp/notochord/cibra/index.htm
 
Update of "Conference on Information Biology" Mar. 17, 2005
Following conferences were added to "Conference on Information Biology"
 
Genome data was added to GIB Mar. 11, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Bacteroides fragilis NCTC 9343 was released by University of Oklahoma, we incorporated it to GIB, and now you can search those data.
Reference: Extensive DNA inversions in the B. fragilis genome control variable gene expression, Science 307, 1463-1465(2005).
 
Preliminary notice for the termination of S&W SEARCH sercice by DDBJ Mar. 9, 2005
S&W SEARCH, one of the homology search services provided through web and e-mail server by DDBJ will be terminated in the near future.
Because of dissolution of the manufacturing company of the hardware by which S&W SEARCH service is provided, we are difficult to maintain the current service for a long time to come. Therefore, as some failure which disrupts our service may happen, S&W SEARCH service by DDBJ will be terminated.
DDBJ also provides SSEARCH which runs by similar algorithm with S&W SEARCH, and this service is continuously available.
Thank you very much for your understanding and cooperation.
 
Update of "Conference on Information Biology" Mar. 8, 2005
Following conferences were added to "Conference on information biology"
 
Integration of ClustalW and ClustalW DDBJ version Mar. 7th, 2005
ClustalW is a multiple alignment and tree-making program provided through web and e-mail server by DDBJ.
On the DDBJ web site, although both ClustalW (ver.1.83) and ClustalW DDBJ version (ver.1.80), which are different in version numbers and available options, have been provided so far, they are integrated shortly.
According to this integration, options (DOTSINOUTPUT and DISTANCE) available only in ClustalW DDBJ version can be used at the updated version ClustalW. A part of user interface is also improved, and URLs are unified to the current ClustalW URL. Updating schedule is as follows, and no service break is scheduled.
Date: April 1, 2005 (Fri)
URL: http://clustalw.ddbj.nig.ac.jp/top-e.html
Updated version no.: 1.83
Completion of version up will be notified on this page.
 
Incomplete ftp from UniProt (SwissProt) in February Mar. 4, 2005
SwissProt has been reorganized as UniProt as of January 1, 2005. Accordingly, the names of their ftp sites have been changed. Without knowing the change we at DDBJ carried out ftp to obtain the UniProt regular and updated releases last month. We are thus afraid that those who retrieved the UniProt data though DDBJ in the period from February 2nd to 25th obtained unsatisfactory results. We apologize for this very much. We are now serving the correct sets of the regular and updated releases of the UniProt data.
 
A link to ARSA was added Feb. 18, 2005
ARSA is the trial keyword search system provided by DDBJ through web. A link to ARSA was added in the left part of DDBJ sites and "Search and Analysis" page.
You can obtain the result within a short time by using ARSA than another DDBJ keyword search systems. Please use ARSA.
 
Genome data was added to GIB Feb. 17, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Neisseria gonorrhoeae FA 1090 was released by University of Oklahoma, we incorporated it to GIB, and now you can search those data.
Reference: The Complete Genome Sequence of Neisseria gonorrhoeae, Unpublished
 
Genome data was added to GIB Feb. 16, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Vibrio fischeri ES114 was released by University of Hawaii, we incorporated it to GIB, and now you can search those data.
Reference: Complete genome sequence of Vibrio fischeri: A symbiotic bacterium with pathogenic congeners, Proc. Natl. Acad. Sci. U.S.A. 102 (8), 3004-3009 (2005)
 
PRF Rel. 101 was released Feb. 15, 2005
PRF (Protein Research Foundation)/SEQ database Release 101 was released on Feb. 15, 2005 at DDBJ. PRF Release 101 consists of 308,406 entries, and the total number of residues reached 107,784,531.
 
SuperSINET service temporary down Feb. 14, 2005
NIG (National Institute of Genetics) network service will be unavailable at the following schedule because of the SuperSINET maintenance. DDBJ network service and NIG supercomputer (supernig and minerva) service will also be unavailable. Thank you very much for your understanding and cooperation.
15 minutes from 8:00 to 9:00, Feb.20(SUN) JST
 
Update of "Conference on Information Biology" Feb. 15, 2005
Following conferences were added to "Conference on information biology"
 
Data were added to GIB Feb. 7th, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Ehrlichia ruminantium Gardel, Ehrlichia ruminantium Welgevonden (CIRAD), Wolbachia endosymbiont TRS of Brugia malayi and Xanthomonas oryzae pv. oryzae KACC10331 were released, we incorporated them to GIB, and now you can search those data.
References (Institutes):
Ehrlichia ruminantium Gardel (CIRAD): Nucleic Acids Res, Unpublished
Ehrlichia ruminantium Welgevonden (CIRAD) (CIRAD): Nucleic Acids Res, Unpublished
Wolbachia endosymbiont TRS of Brugia malayi (New England Biolabs ): The Wolbachia genome of Brugia malayi: endosymbiont evolution within a human pathogenic nematode, PLoS Biol. (2005) In press
Xanthomonas oryzae pv. oryzae KACC10331 (National Institute of Agricultural Biotechnology): The genome sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight pathogen of rice, Nucleic Acids Res. 33 (2), 577-586 (2005)
 
Genome data was added to GIB Feb. 2nd, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Lactobacillus acidophilus NCFM was released by North Carolina State University, we incorporated it to GIB, and now you can search those data.
Reference: Complete genome sequence of the probiotic lactic acid bacterium Lactobacillus acidophilus NCFM, Proc Natl Acad Sci U S A. 2005 Jan 25 [Epub ahead of print]
 
NIG Network service temporary down Feb. 1st, 2005
NIG (National Institute of Genetics) network service will be unavailable at the following schedule because of the network maintenance. DDBJ network service and NIG supercomputer (supernig and minerva) service will also be unavailable. Thank you very much for your understanding and cooperation.
From Feb. 8th (TUE) 18:00 to 22:00
 
Update of "Conference on information biology" Jan. 31, 2005
Following conferences were added to "Conference on information biology"
 
Genome data was added to GIB Jan. 26, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Gluconobacter oxydans 621H was released by Goettingen Genomics Laboratory, we incorporated it to GIB, and now you can search those data.
Reference: Complete genome sequence of the acetogenic bacterium Gluconobacter oxydans, Nat. Biotechnol. (2005) In press
 
Release of a large amount of transcript sequences in new category MGA (Mass sequence for Genome Annotation) Jan. 24, 2005
The International Nucleotide Sequence Databases (INSD) discussed the issue of receiving and releasing huge amounts of transcript sequence, each of which is a 5' end short-length transcript approximately 20 bp in length. They are produced by the CAGE (Cap Analysis Genome Expression) method and thus called the CAGE sequences. INSD then agreed that the sequences be submitted and released as a new category, MGA (Mass sequence for Genome Annotation), because the sequences are of new type and not fit to any of the extant divisions or categories.
 
Definition of MGA
MGA is defined as those sequences which are produced in large quantity in view of genome annotation.
 
The first set of MGA was released on January 24, 2005. The MGA data for mouse were submitted from Dr. Yoshihide Hayashizaki and his colleagues of the Genome Sciences Center at RIKEN. The total number of sequence entries this time is 383,264. The MGA data can be downloaded at the ftp site,
 
URL: ftp://ftp.ddbj.nig.ac.jp/ddbj_database/mga/project_index.html
 
You can jump to the above ftp site from "Anonymous FTP of the DDBJ" page of DDBJ HP.
Most of the present MGA sequences are associated with the gene expression data which have already been released at CIBEX (http://cibex.nig.ac.jp/index.jsp), one of the international gene expression databases, operated at the Center for Information Biology and DNA Data Bank of Japan.
 
PIR rel. 80 was released Jan. 18, 2005
PIR Release 80 was released on Jan. 21, 2005 at DDBJ. PIR Release consists of 283,416 entries, and the total number of residues reached 96,216,763.
FTP site for DB download
 
Statistics [Top 30 organisms according to the total number of nucleotides] Update Jan. 20, 2005
Top 30 organisms according to the total number of nucleotides (- DDBJ rel.60) in DDBJ statistics was updated with releasing DDBJ Rel. 60. Click the organism name to view the graph of change.
 
Data was added to GIB Jan. 20, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Staphylococcus epidermidis RP62A was released by TIGR, we incorporated it to GIB, and now you can search this data.
Reference:
Staphylococcus epidermidis RP62A genome sequence, Unpublished (2004)
 
DAD rel. 30 was released Jan. 18, 2005
DDBJ amino acid database (DAD) Release 30 was released on Jan. 18, 2005 at DDBJ. DAD Release consists of 2,169,069 entries, and the total number of residues reached 669,311,612.
FTP site for DB download
 
Data were added to GIB Jan. 18, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Thermococcus kodakaraensis KOD1 and Staphylococcus aureus subsp. aureus COL were released by Kyoto Univ. and TIGR, we incorporated them to GIB, and now you can search those data.
Reference:
Thermococcus kodakaraensis KOD1: Complete Genome Sequence of the Hyperthermophilic Archaeon Thermococcus kodakaraensis KOD1 and Comparison with Pyrococcus Genomes, Unpublished (2004)
Staphylococcus aureus subsp. aureus COL: Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin resistant Staphylococcus aureus and a biofilm producing methicillin resistant Staphylococcus epidermidis, J. Bacteriol. (2005) In press
 
Data were added to GIB Jan. 11, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Campylobacter jejuni RM1221 and Dehalococcoides ethenogenes 195 were released by TIGR, we incorporated them to GIB, and now you can search those data.
References (Institutes):
Campylobacter jejuni RM1221: Major structural and novel potential virulence mechanisms from the genomes of multiple Campylobacter species, (er) PLoS Biol. 3 (1), doi 10.1371/journal.pbio.0030040 (2005)
Dehalococcoides ethenogenes 195: Genome Sequence of the PCE-Dechlorinating Bacterium, Dehalococcoides ethenogenes, Science 307 (5706), 105-108 (2005)
 
Genome data was added to GIB Jan. 7th, 2005
GIB (Genome Information Broker) provides an integrated search of Bacteria, Archaea, Eukaryota complete genome sequences. Because the genome sequence data of Ehrlichia ruminantium Welgevonden was released by University of Pretoria, we incorporated it to GIB, and now you can search those data.
Reference: The genome of the heartwater agent, Ehrlichia ruminantium, contains multiple tandem repeats of actively variable copy number, Proc. Natl. Acad. Sci. U.S.A. 102, 838-843(2005).
 
 
Current What's New
What's New past
| 2006 |
| 2005 | 2004 | 2003 | 2002 | 2001 |
| 2000 | 1999 | 1998 |
Last modified: Jun. 15, 2011