DDBJ Center News Archive

News from 1999

Human Chromosome 22 Sequence Completed

1999年12月10日
Human genome project teams of US, Europe, and Japan completed the sequence of human chromosome 22 (33.4 million bps).This chromosome contains 545 genes and 134 pseudogenes, and it is about 1 % of the whole human genome.Keio University team headed by Professor Nobuyoshi Shimizu, Sanger Centre in U.K., University of Okurahoma and Washington University in U.S.A. determined thosesequences.
The Keio University team submitted their data to DDBJ, and we released to public in DDBJ/EMBL/GenBank International Nucleotide Sequence Database.
Services: ddbj Keywords:

Human Chromosome 22 Sequence Completed

December 10,1999
Human genome project teams of US, Europe, and Japan completed the sequence of human chromosome 22 (33.4 million bps).This chromosome contains 545 genes and 134 pseudogenes, and it is about 1 % of the whole human genome.
Keio University team headed by Professor Nobuyoshi Shimizu, Sanger Centre in U.K., University of Okurahoma and Washington University in U.S.A. determined those sequences.
The Keio University team submitted their data to DDBJ, and we released to public in DDBJ/EMBL/GenBank International Nucleotide Sequence Database.

List of the Keio University team's data (90 entries, 5,453,751 bps)
D86989, D86991, D86993-D86996, D86998-D87000, D87002-D87004, D87006-D87007, D87009-D87024, D88268-D88271, AP000343-AP000362, AP000365, AP000522-AP000547, AP000550-AP000558
Services: ddbj Keywords:

supernig periodic maintenance

December 03,1999
Supernig service will be unavailable during the following date because of the periodic maintenance.We appreciate your cooperation.
Dec. 17 (Fri.) 12:00 - Dec. 18 (Sat.) 14:00
Services: ddbj Keywords:

supernig periodic maintenance

November 11,1999
Supernig service will be unavailable during the following date because of the periodic maintenance.We appreciate your cooperation.
Nov. 19 (Fri.) 12:00 - 21:00
Services: ddbj Keywords:

Announcement about the New Year Holidays of DDBJ

November 11,1999
We at DDBJ will suspend our business during the New Year Holidays in the following schedule.
We will stop most activities including issuing the accession numbers during that period, and resume the normal business on Jan. 5 , 2000.

Dec. 24, 1999 (Fri.) 12:00 Stop receiving data
Dec. 27, 1999 (Mon.) 9:00 Stop all the activities
Jan. 5, 2000 (Wed.) Resume all the activities

Thank you for your cooperation. We wish you a Happy New Year.

DNA Data Bank of Japan

*National Institute of Genetics computer system will be unavailable from December 27, 1999 to January 4, 2000 so as to avoid any possible problems which may arise due to the so-called Y2K problem.
Services: ddbj Keywords:

DDBJ Rel. 39 Completed

November 02,1999
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media.We completed DDBJ Release 39 in November 2nd, 1999.
DDBJ Release 39 consists of 4,810,773 entries, and the number of bases reached 3,728,000,562.
We introduced VERSION number (Nucleotide ID and Protein ID) into operation from release 37. According to this, use of NID and PID were terminated from release 39.New prefix of accession number, AX and AY were added from this release.AX will be used by EMBL for patent data, and AY for direct submission by GenBank.
Services: ddbj Keywords:

NIG network service temporary down

November 02,1999
NIG (National Institute of Genetics) network service will be unavailable during the following dates because of the electric power cut.We appreciate your cooperation.
Nov. 12 (Fri) 17:00 - 13 (Sat) 21:00
* supernig will be unavailable from Nov. 12 (Fri) 12:00 to 13 (Sat) 21:00.
Services: ddbj Keywords:

SAKURA server temporary down

October 15,1999
A part of the SAKURA service will be down temporarily because of the SAKURA server upgrading, as follows.
We appreciate your cooperation.
Affected service: SAKURA, TxSearch, Mass submission template constructing system
Date: Wed., Oct. 20, 9:00-13:00
Services: ddbj Keywords:

supernig periodic maintenance

October 07,1999
Supernig service will be unavailable during the following date because of the periodic maintenance.We appreciate your cooperation.
Oct. 15 (Fri) 12:00 - 21:00
Services: ddbj Keywords:

Elimination of EMBL, EMBLNEW and GBNEW from supernig and VPP500

October 05,1999
EMBL, EMBLNEW and GBNEW databases were dropped from NIG mainframe computers(supernig and VPP500) as of October 1st, 1999.Now you can use only DDBJ and DDBJNEW on supernig and VPP500.It should be noted that the DDBJ/EMBL/GenBank International Nucleotide Sequence Database shares the same data.Difference among DDBJ, EMBL and GenBank databases are only their formats.
Services: ddbj Keywords:

Elimination of NID and PID from DDBJ database

October 01,1999
DDBJ/EMBL/GenBank International Nucleotide Sequence Database decided to introduce sequence version number (version line for nucleotide sequences and /protein_id for amino acid sequences) at the collaborators meeting held at Mishima this year.
Because of this change, DDBJ will eliminate NID and PID, which are currently included in the DDBJ database entries, starting DDBJ release 39 (Oct. 1999).Before that release, entries which will be open after September 30 will no longer have NID nor PID.PID and NID will be eliminated from all the entries after distribution of DDBJ release 39.
Services: ddbj Keywords:

SINET (Internet connection between NIG and outside) temporary down

September 30,1999
Some NIG network service will be down temporarily because of the SINET upgrading, as follows. It may take some time to recover the whole system.We appreciate your cooperation.
Date: Friday, October 1, 12:00 - 14:00
Affected service: Internet connection between NIG and outside
Services: ddbj Keywords:

DDBJ Released 7.3 Mb of Human Genome Data

September 21,1999
DDBJ released human genome data submitted by the Sakaki (RIKEN/Univ. of Tokyo) and the Shimizu (Keio Univ) teams as of September 13.
This time the Sakaki team submitted data of 60 clones from chromosomes 11 and 21 (AP000431-AP000490) and the Shimizu team submitted those of 7 clones from chromosome 8 (AP000424-AP000430).The total number of bases for the 67 clones together is about 7.3 Mb.This means that the Japanese Human Genome Groups have submitted and released through DDBJ about 25.3 Mb in total in the past year.
Services: ddbj Keywords:

supernig periodic maintenance

September 10,1999
Supernig service will be unavailable during the following date because of the periodic maintenance.
Sep. 17 (Fri) 12:00 - 21:00
Services: ddbj Keywords:

DAD Rel.8, was released

September 06,1999
DDBJ amino acid database (DAD) Release 8 was released on Aug. 30, 1999 at DDBJ.DAD Release 8 consists of 419,30 entries, and the total number of residues reached 128,581,164.
Services: ddbj Keywords:

supernig periodic maintenance

August 19,1999
Supernig service will be unavailable during the following date because of the periodic maintenance.
August 27 (Fri) 12:00 - 21:00
Services: ddbj Keywords:

PIR Release 61 was released

August 17,1999
PIR amino acid database Release 61 was released on line to the public on Aug. 10, 1999 at DDBJ.PIR Release 61 consists of 130,886 entries, and the total number of residues reached 43,065,574.
Services: ddbj Keywords:

EMBL Release 59 was released

August 10,1999
EMBL Release 59 was released on line to the public on Aug. 10, 1999 at DDBJ.EMBL Release 59 consists of 3,952,878 entries, and the total number of bases reached 2,924,568,545.
Services: ddbj Keywords:

fixing Y2K preblem on supernig

August 05,1999
Supernig service will be unavailable during the following dates due to fix Y2K preblem.
August 11 (Wed) 10:00 - 13 (Fri) 18:00
Services: ddbj Keywords:

DDBJ Rel. 38 Completed

August 02,1999
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media.We completed DDBJ Release 38 in July 30, 1999. DDBJ Release 38 consists of 4,294,369 entries, and the number of bases reached 3,098,519,597.Proportions of entries collected in Japan, U. S. A. and Europe are 11%, 81.8% and 7.9%.On the last release, the number of entries collected in Japan exceeded European ones for the first time. At this release 38, the difference increased.
We had put new system VERSION number (Nucleotide ID and Protein ID) into operation from release 37. According to this, NID and PID will be terminated on release 39 (October 1999) .
Please see DDBJ statitics for more information
Services: ddbj Keywords:

28,000 nematode ESTs have been made public

August 02,1999
Sequences of C. elegans ESTs 28,278 entries have been submitted to DDBJ by Dr. Y. Kohara at Genetic Resources Laboratory, Center for Genetic Resource Information, the National Institute of Genetics.We assigned accession numbers AV175735-AV204012 to these sequences, and released them in the EST division of the DDBJ/EMBL/GenBank International Nucleotide Sequence Database.
Services: ddbj Keywords:

Pyrococcus abyssi was added to GIB

July 28,1999
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequence data of Pyrococcus abyssi were released, we incorporated them to GIB, and now you can search those data.
Services: ddbj Keywords:

supernig periodic maintenance

July 15,1999
It happens in the following date, and be lets the service of supernig be suspended for the periodic maintenance of supernig.
Jul. 23 (Fri.) 12:00 - 21:00
Services: ddbj Keywords:

A modification to the homology search service

July 14,1999
We increased the number of target division on the DDBJ FASTA/BLAST/SSEARCH homology search system.When you specify [DDBJ release] as the target database, you can select target divisions from list box.In EST division, 6 target divisions were available.We added 25 EST divisions to this list.Now you can use 31 EST divisions which are from top 30 organisms and others.Multiple selection is also available.
List of new target division:
Drosophila melanogaster, Rattus norvegicus, Saccharomyces cerevisiae, Rattus sp. , Schizosaccharomyces pombe, Plasmodium falciparum, Danio rerio,Dictyostelium discoideum, Brugia malayi,Magnaporthe grisea, Emericella nidulans, Neurospora crassa, Bombyx mori, Zea mays, Toxoplasma gondii, Xenopus laevis, Oryctolagus cuniculus, Trypanosoma cruzi,
Sus scrofa, Onchocerca volvulus, Glycine max, Schistosoma mansoni, Lycopersiconesculentum, Leishmania major, Cryptosporidium parvum
Services: ddbj Keywords:

175,000 mouse ESTs have been made public

June 28,1999
Sequences of Mus musculus cDNA have been submitted to DDBJ by Dr. Y. Hayashizaki (Project Leader)'s team at the RIKEN(Institute of Physical and Chemical Research) Genomic Sciences Center.We assigned accession numbers AV000001-AV175734 to these sequences,and released them in the EST division of the DDBJ/EMBL/GenBank International Nucleotide Sequence Database.
Services: ddbj Keywords:

Aeropyrum pernix was added to GIB

June 28,1999
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.Because the complete genome sequence data of Aeropyrum pernix were released by DDBJ, we incorporated them to GIB, and now you can search those data.Accession numbers of those data are AP000058-AP000064.
Services: ddbj Keywords:

Thermotoga maritima was added to GIB

June 10,1999
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.Because the complete genome sequence data of Thermotoga maritima were released, we incorporated them to GIB, and now you can search those data.
Services: ddbj Keywords:

SAKURA Version 2.24 released

June 10,1999
SAKURA Version 2.24 was released on June 8.
- Feature information (CDS feature, Other Features and Qualifiers) was changed to mandatory. If there is no information on feature fields, you will receive an error message.
- Related to the change of feature information treatment,explanation was added on the Japanese top page. Construction and background were also changed.
- Recently, the number of authors on [Primary Citation] field are increasing. So, we changed maximum number of authors from 10 to 20 on [Primary Citation] field.
Services: ddbj Keywords:

supernig periodic maintenance

June 10,1999
It happens in the following date, and be lets the service of supernig be suspended for the periodic maintenance of supernig.
Jun. 18 (Fri.) 12:00 - 21:00
Services: ddbj Keywords:

PDB Rel. 87 was released

June 04,1999
PDB rel. 87 was released on line to the public on Jun. 2, 1999 at DDBJ.PDB rel. 87 consists of 9,179 entries.
Services: ddbj Keywords:

get-version released

June 02,1999
DDBJ introduced a new system to identify for both nucleotide and protein sequences with version numbers (Nucleotide ID and Protein ID) since DDBJ rel. 37 (Mar. 1999).Therefore DDBJ released "get-version" system which is able to search these version numbers.To use this system, send an e-mail message containing the formatted query ACCESSION and VERSION NUMBER to the following e-mail address "get-version@nig.ac.jp".If you need help message, please send e-mail to get-version@nig.ac.jp with the word "help-e" in the mail body.
Services: ddbj Keywords:

supernig periodic maintenance

May 21,1999
It happens in the following date, and be lets the service of supernig be suspended for the periodic maintenance of supernig.
May 26 (Wed) 9:00 - 28 (Fri) 21:00
Services: ddbj Keywords:

CAUTION !

May 19,1999
We at DDBJ will stop our service of receiving DNA sequence data by SAKURA,
issuing accession numbers and updating submitted data during the following period, because of grading up our server machines.Thanks for your understanding and cooperation.
From : 1999.5.21 (Fri) 8:30 a.m.
To   : 1999.5.24 (Mon) 10:00 a.m.
Services: ddbj Keywords:

International Nucleotide Sequence Database Collaborative and Advisory Meetings

May 18,1999
The International Nucleotide Sequence Databanks, CIB/DDBJ, EBI/EMBL,and NCBI/GenBank, hold the Collaborative Meeting once a year and the Advisory Meeting every other year in order to scheme operation and continuation of the construction of the DNA database international collaboration.
The host of this year was DDBJ, and the meetings were held in Mishima:the International Collaborative Meeting from April 19 to 21; the International Advisory Meeting from April 22 to 23.The attendance from U.S.A. was six, from Europe was eleven.
Services: ddbj Keywords:

13 Mbases of human chromosome 21 have been made public (ACC#AP000084 - ACC#AP000219) 

May 17,1999
Sequences of three regions of human chromosome 21, 21q21.1, 21q22.1,21q22.3-ter, have been submitted to DDBJ by Dr. Y. Sakaki's team of the Institute of Physical and Chemical Research (RIKEN).
We assigned accession numbers, AP000136-AP000219, to these sequences, and released to public as HTG Division in DDBJ/EMBL/GenBank International Nucleotide Sequence Database.Prior to the present release, we already publicized another set of sequences of human chromosome 21 (21q22.1) with accession numbers AP000084-AP000135 which were submitted by the Japan Science Technology Corporati on (JST).
In total we have made public about 13 Mbases of human genome sequence data.
Links to these entries
Services: ddbj Keywords:

supernig periodic maintenance

April 16,1999
It happens in the following date, and be lets the service of supernig be suspended for the periodic maintenance of supernig.
Apr. 23 (Fri) 12:00 - 21:00
Services: ddbj Keywords:

EMBL Release 58 was released

April 16,1999
EMBL Release 58 was released on line to the public on Apr. 15, 1999 at DDBJ. EMBL Release 58 consists of 3,272,064 entries, and the total number of basesreached 2,355,200,790.
Services: ddbj Keywords:

DDBJ Rel. 37 Completed

April 05,1999
The nucleotide sequence database collected and maintained by DDBJ is quarterly released on line to the public and distributed in the magnetic media.We completed DDBJ Release 37 in Mar. 26, 1999. DDBJ Release 37 consists of 3,311
,627 entries,and the number of bases reached 2,375,261,951.
Since the content of a nucleotide sequence is often revised due to replacements,additions and deletions of bases made by the submitter,the accession number sometimes does not work to tell which sequence is really in question.Thus, an additional identifier was introduced to specify a particular sequence in a series of revised sequences.This identifier is called NID. For the same reason for translated amino acid sequences, PID was brought into being.
Services: ddbj Keywords:

NIG DNA database advisory committee

April 05,1999
DNA Database Advisory Committee is held annually at the National Institute of Genetics for the purpose of recommendation about DNA database activity plans such as data construction, software development, and service. This year, the meeting was held on March 25.
Services: ddbj Keywords:

New homology search service

March 17,1999
DDBJ added new functions to homology search syshtmltem in DDBJ WWW site.
1. DAD and SWISS-PROT databases include new data. DAD is updated everyday,and SWISS-PROT is every Friday.
2.You can receive results by e-mail in HTML format, and can load them into a web browser for viewing.

To use this function in web site:When you select E-Mail at RESULT, please use check box of [In HTML format].
To use this function using e-mail server:Please add a new line "html 1" in your request.

      ex.)     program      blastn               datalib      ddbj               scores       100               
               alignments   100               expect       10               gap          1       
               filter       1               html         1      query               
               aaacccgggtttaaaaaaaacggttttt               ...........               // 
Services: ddbj Keywords:

LIBRA I updates

March 16,1999
LIBLA I is a computer application for analyzing protein structures and sequendes.Inverse folding search (Compatible Sequence Search with a query structure) by LIBRA I has been available.
Services: ddbj Keywords:

supernig periodic maintenance

March 11,1999
It happens in the following date, and be lets the service of supernig be suspended for the periodic maintenance of supernig.
Mar. 19 (Fri) 12:00 - 21:00
Services: ddbj Keywords:

SAKURA V2.23 released

March 03,1999
SAKURA V2.23 was released on March 3rd. SAKURA V2.23 is updated version of SAKURA V2.22, and added a new function of adding /focus qualifier automatically.
Services: ddbj Keywords:

GenBank terminated to accept Authorin submission

February 17,1999
GenBank has been phasing out use of Authorin as a data submission tool. We DDBJ still accept Authorin submissions. However, we terminated distribution, because Authorin is not compatible with Macintosh 32bit
addressing nor Windows.
We DDBJ recommend you to use SAKURA on the Web or sequin ver. 2.6,a stand-alone program for PC, Macintosh, and Unix platforms.
Services: ddbj Keywords:

PIR Release 59 was released

February 17,1999
PIR amino acid database Release 59 was released on line to the public on Feb. 17, 1999 at DDBJ. PIR Release 59 consists of 117,704 entries, and the total number of residues reached 37,890,243.
Services: ddbj Keywords:

supernig periodic maintenance

February 17,1999
It happens in the following date, and be lets the service of supernig be sus pended for the periodic maintenance of supernig.
Feb. 26 (Fri) 12:00 - 21:00
Services: ddbj Keywords:

C. elegans genome data are appended to DDBJ homology search service

February 05,1999
C. elegans genome data (DNA and Protein) were appended for DDBJ homology search service ( FASTA/BLAST/PSI-BLAST/SSEARCH).
"C. elegans[wormpep](protein)" and "C. elegans (DNA)" are available as a target database.
When "C. elegans[wormpep](protein)" was specified, there is a dynamic link to the wormace at Sanger Centre from the result. It is available through the DDBJ WWW server and DDBJ E-mail server.


Information about comment of DNA data are below.chromosome number/ start-end, source, feature, [group]These are from GFF format(http://www.sanger.ac.uk/Users/rd/gff.shtml).

start, end
Integers. "start" must be less than or equal to "end".Sequence numbering starts at 1, so these numbers should be between 1 and the length of the relevant sequence, inclusive.
source
The source of this feature. This field will normally be used to indicate the program making the prediction,
or if it comes from public database annotation, or is experimentally verified, etc.
feature
The feature type name. We hope to suggest a standard set of features, to facilitate import/export, comparison etc.. Of course, people are free to define new ones as needed.
For example, Genie splice detectors account for a region of DNA, and multiple detectors may be available for the same site, as shown above.
[group]
An optional string-valued field that can be used as a name to group together a set of records. Typical uses might be to group the introns and exons in one gene prediction (or experimentally verified gene structure), or to group multiple regions of match to another sequence, such as an EST or a protein.

Services: ddbj Keywords:

Continuation of the GDB project

January 26,1999
It has been decided that the Genome Database (GDB) project,whose termination was announced on this site (Oct. 13, 1998),
will continue its activities.While data curation will continue at The Johns Hopkins University School of Medicine in Baltimore (JHU), replication of data to the international nodes will occur from a central editable node at the Bioinformatics Centre at the Hospital for Sick Children (HSC) in Toronto, Canada (http://bioinfo.sickkids.on.ca/gdb/temp.html).Transfer of the primary node to HSC will take place by early 1999.Please see http://gdbwww.gdb.org/ for more information.
Services: ddbj Keywords:

DDBJ Rel. 36 Completed

January 18,1999
The nucleotide sequence database collected and maintained by DDBJ is quarterly released on line to the public and distributed in the magnetic media.
We completed DDBJ Release 36 in Jan. 14, 1998. DDBJ Release 36 consists of 3,073,166 entries, and the number of bases reached 2,190,425,560.
Services: ddbj Keywords:

supernig periodic maintenance

January 18,1999
It happens in the following date, and be lets the service of supernig be suspended for the periodic maintenance of supernig.
Jan. 22 (Fri) 12:00 - 21:00
Services: ddbj Keywords:

SRS is now available in DDBJ WWW site

January 18,1999
SRS is the sequence retrieval system developed by EBI.DDBJ modified it for DDBJ databases and made available this system.
Target database
- sequence database : DDBJ, DDBJNEW, DAD, SWISSPROT, PIR
- sequence-related database: PROSITE, PROSITEDOC, ENZYME
- protein tertiary structure database: PDB
The URL is http://ftp2.ddbj.nig.ac.jp:8000/srs/ .This has a link from [Database Searches and Data Analyses] of DDBJ Home Page.
Services: ddbj Keywords:
  • Partners

  • NIG logo
  • ROIS logo
  • JBI logo
  • NBDC logo
  • DBCLS logo
  • PDBj logo