DDBJ Center News Archive

News from 2001

NIG network service temporary down

NIG (National Institute of Genetics) network service will be unavailable during the following dates because of the network maintenance.
Thank you for your understanding and cooperation.
Dec. 27 (Thu) 15:00 - 28 (Fri) 9:00
Services: ddbj Keywords:

Extended version of CLUSTALW by DDBJ was released

December 20,2001
CLUSTALW is the program for multiple alignment and tree-making. DDBJ released an extended version of CLUSTALW on Dec. 7, 2001. The extended options are as follows:
- When you specify ALIGN "on" for multiple alignments, dot option is available. In this description, identical part of the sequences are indicated as dot (see example).
- When you specify TREE "on" to reconstruct a phylogenetic tree from nucleotide sequences, as a method for estimation of a genetic distance, Tamura, Tajima-Nei, Gojobori-Ishii-Nei 6-parameter and Tamura-Nei as well as Jukes-Cantor and Kimura 2-parameter, can be selected.
example : CLUSTAL W (1.81) multiple sequence alignment A1-1_A101      GGCCGACCCTTCGGCCCGGGGGCCA1-2_A102      ......T.................A1-3_A103      NNNN..T.T...............A1-4_A104      NNNN.G..................A2             NNNN..T................-AX             NNNN......A.............A3-1           NNNN................A...cis-AB         NNNN..T...........C.....O-1_O101       ....-...................O-2_O201       TATT-G....A.A..T...A....O-3            NNNN.G.G.........A......O-4_O102       NNNN-....C..............O-5_O103       NNNN-G..................O-6_O202       NNNN-.....A.A..T...A....O-7_O203       NNNN-G....A.A.TT...A....B-1_B101       .....G.G...T.A..A.C..A..B-2_B102       NNNN.G.G...T.A..A.C.....B-3_B103       NNNN.G.G.....A..A.C..A..B(A)           NNNN.G.G........A.C..A..B3-1           NNNN.G.G...T.A..A.C..AT.               ************************
Services: ddbj Keywords:

Updates of "Conference on information biology"

December 19,2001
Evolution 2002 (June 28-July 2, 2002) and Bio China 2002 (August 28-31, 2002) were added to "Conference on information biology".
Services: ddbj Keywords:

Agrobacterium tumefaciens C58 (Dupont) was added to GIB

December 18,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequence data of Agrobacterium tumefaciens C58 (Dupont) was released, we incorporated it to GIB, and now you can search those data.
Institute: University of Washington
Reference: The Genome of the Natural Genetic Engineer Agrobacterium tumefaciens C58, Science 294 (5550), 2317-2323 (2001)
Services: ddbj Keywords:

Ralstonia solanacearum GMI1000 was added to GIB

December 12,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequence data of Ralstonia solanacearum GMI1000 was released, we incorporated it to GIB, and now you can search
those data.
Institute: Genoscope and CNRS UMR-8030
Reference: Genome sequence of the plant pathogen Ralstonia solanacearum, Unpublished
Services: ddbj Keywords:

Version-up of TXSearch

December 11,2001
TXsearch is a retrieval system for a Taxonomy Database unified by DDBJ, GenBank and EMBL. DDBJ released TXSearch Version 2.0 on Dec. 7, 2001. The main purpose of this version-up was to accommodate the system to RDB. Although no function was newly added, the maximum number of retrieval results was changed from 1000 to infinity.
Services: ddbj Keywords:

Suspension of the DDBJ activity during the New Year Holidays

December 07,2001
We at DDBJ will suspend our business during the New Year Holidays from December 29th, 2001 to January 3rd, 2002. We will stop most activities including receiving data and issuing
accession numbers during that period, and resume the normal business on January 4th, 2002.
Please note in particular that SAKURA will stop in operation from December 26th, 2001 to January 3rd, 2002.
Thank you very much for your understanding and cooperation.
We wish you a Merry Christmas and Happy New year.
DNA Data Bank of Japan
Services: ddbj Keywords:

PIR rel. 70 was released

December 06,2001
PIR Rel. 70 was released on Dec. 6, 2001 at DDBJ. PIR Rel. 70 consists of 250,417 entries, and the total number of residues reached 85,931,133 aa.
Services: ddbj Keywords:

Nostoc sp. PCC 7120 was added to GIB

December 05,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Nostoc sp. PCC 7120 was released, we incorporated it to GIB, and now you can search those data.
Institute: Kazusa DNA Research Institute
Reference: Complete Genomic Sequence of the Filamentous Nitrogen-fixing Cyanobacterium Anabaena sp. strain PCC 7120, DNA Res. 8, 205-213 (2001)
Services: ddbj Keywords:

PRF Rel. 82 was released

December 05,2001
PRF (Protein Research Foundation)/SEQ database Release 82 was released on Dec. 4, 2001 at DDBJ. PRF Release 82 consists of 184,903 entries, and the total number of residues reached 66,779,128.
Services: ddbj Keywords:

NIG network service temporary down

November 29,2001
NIG (National Institute of Genetics) network service will be unavailable during the following date because of the network maintenance.Thank you for your understanding and cooperation.
Dec. 1st (Sat) 13:00 - 21:00
Services: ddbj Keywords:

Recovery of the DDBJ web pages

November 27,2001
Due to an accident of the server maintenance, some pages could not be accessed from Nov. 17 to 26. They are recovered now.
We apologize for the inconvenience and thank you for your understanding.
Services: ddbj Keywords:

DAD rel. 17 was released

November 27,2001
DDBJ amino acid database (DAD) Release 17 was released on Nov. 19, 2001 at DDBJ. DAD Release 17 consists of 863,193 entries, and the total number of residues reached 265,285,159.
Services: ddbj Keywords:

SWISS-PROT Rel. 40 was released

November 27,2001
SWISS-PROT Rel. 40 was released on Nov. 19, 2001 at DDBJ. SWISS-PROT Rel. 40 consists of 101,602 entries, and the total number of residues reached 37,315,215.
Services: ddbj Keywords:

Reopen the DDBJ release in XML (DDBJ-XML V.1.1)

November 14,2001
DDBJ reopened the whole release retrieve service in XML format.
XML formatted files of DDBJ release 47 (Dec. 2001) can be retrieved through the following anonymous FTP:
DDBJ started to provide unified daily update data (NEW data) in XML format.
Newly-arrived/updated entries after the last release are now available through the following anonymous FTP:
Services: ddbj Keywords:

NIG network service temporary down

November 08,2001
NIG (National Institute of Genetics) network service will be unavailable during the following dates because of the electric power cut. We appreciate your cooperation.
Nov. 16 (Fri) 17:00 - 18 (Sun) 9:00
Services: ddbj Keywords:

Listeria innocua Clip11262 and Listeria monocytogenes EGD-e were added to GIB

November 01,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequence data of Listeria innocua Clip11262 and Listeria monocytogenes EGD-e were released, we incorporated them to GIB, and now you can search those data.

Institute: Institut Pasteur
Reference:Comparative genomics of Listeria species, Science 294, 849-852 (2001)
Services: ddbj Keywords:

>Salmonella typhi CT18 was added to GIB

October 31,2001
GIB (Genome Information Broker forMicrobial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequence data of Salmonella typhi CT18 was released, we incorporated it to GIB, and now you can search those data.

Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18, Nature 413, 848-852 (2001)
Services: ddbj Keywords:

Updates of "Conference on information biology"

October 29,2001
HGM 2002 (April 14-17, 2002) and 4th HUGO Pacific Meeting and 5th Asia-Pacific Conference on Human Genetics (October 27-30, 2002) were added to "Conference on information biology".
Services: ddbj Keywords:

Salmonella typhimurium LT2 was added to GIB

October 29,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the following genome sequence data of Salmonella typhimurium LT2was released, we incorporated it to GIB, and now you can search those data.

The complete genome sequence of Salmonella enterica serovar Typhimurium LT2:features revealed by comparison to related genomes, Nature 413, 852-856 (2001)
Services: ddbj Keywords:

PRF/SEQ database was added to DDBJ search services as a target database

October 25,2001
DDBJ added PRF (Protein Research Foundation)/SEQ database to DDBJ search services (fasta, blast, psi-blast, ssearch and getentry) as a target database. PRF/SEQ database Rel. 81 is available now. Rel. 81 consists of 177,941 entries, and the total number of residues is 64,250,763 aa.
* PRF/SEQ database consists of amino acid sequences of peptides and proteins, including sequences deduced from genes collected by Protein Research Foundation.
Services: ddbj Keywords:

Updates of "Conference on information biology"

October 23,2001
THE SIX SHIZUOKA FORUM ON HEALTH AND LONGEVITY(November 9-10, 2001) was added to "Conference on information biology".
Services: ddbj Keywords:

Updates of "Conference on information biololgy"

October 22,2001
BGRS'2002(July 14-20, 2002) was added to "Conference on information biology".
Services: ddbj Keywords:

Yersina pestis CO92 was added to GIB

October 16,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequence data of Yersina pestis CO92 was released, we incorporated it to GIB, and now you can search those data.

Genome sequence of Yersinia pestis, the causative agent of plague, Nature 413, 523-527(2001)
Services: ddbj Keywords:

DDBJ Rel. 47 Completed

October 16,2001
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media. We completed DDBJ Release 47 in Oct. 2001. DDBJ Release 47 consists of 13,266,610 entries, and the number of bases reached 14,145,671,645.
Services: ddbj Keywords:

supernig periodic maintenance

October 12,2001
Supernig service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Oct. 19, 2001 (Fri) 12:00-21:00
Services: ddbj Keywords:

Updates of "Conference on information biology"

October 11,2001
Bioinformatics 2002 (February 6-8, 2002) was added to "Conference on information biology".
Services: ddbj Keywords:

Version-up of GIB

October 01,2001
We enhanced GIB to version 3.0 to accommodate rapidly increasing genomic information. GIB 3.0 uses distributed RDBs on multiple PC-Linux platforms and a homology search server on Unix platform. The WWW server communicates with these servers by use of
CORBA and XML. The new version of GIB stores, processes and displays all the features in the Flat Files including CDS and RNA. In a comparative genomes page of GIB 3.0, you can select multiple genomes that you are interested in. The user interface is improved in GIB 3.0 as well.
Services: ddbj Keywords:

Streptococcus pneumoniae R6,Rickettsia conorii and Sulfolobus tokodaii were added to GIB

September 18,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the following genome sequencedata were released, we incorporated them to GIB, and now you can search those data.
Streptococcus pneumoniae R6

Institute: Eli Lilly and Company: Genome of the Bacterium
Reference: Streptococcus pneumoniae Strain R6, J. Bacteriol. 183 (19),5709-5717 (2001)

Rickettsia conorii

Institute: Genoscope, Universite de la Mediterranee
Reference: Mechanisms of Evolution in Rickettsia conorii and Rickettsia prowazekii, Science 293, 2093-2098 (2001)

Sulfolobus tokodaii

Institute: National Institute of Technology and Evaluation
Reference: Complete genome sequence of an Aerobic Thermoacidophilic Crenarchaeon, Sulfolobus tokodaii strain7. DNA Res.(2001) In press
Services: ddbj Keywords:

Minerva periodic maintenance

September 14,2001
Minerva service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Sep. 21, 2001 (Fri) 10:00 a. m. - 22:00 p. m.
Services: ddbj Keywords:

Temporary stop of the XML format distribution

September 12,2001
DDBJ stopped data distribution in XML format temporary because of a system trouble. It will recover in a week.
Thank you very much for your understanding and cooperation.
Services: ddbj Keywords:

ERROR occurred in the HOMOLOGY SEARCH !!!

August 24,2001
We apologize to those who used:
- either FASTA or BLAST
- by sending query and getting results via the WWW interface (*)
- during July 17th and August 23rd
- to search the database "DDBJ all data (DNA)" and the division of "Invertebrate", "Plant" or "Bacteria"
The system returned you wrong results.
We express regret for your inconvenience caused by the error.
(*) The information is valid, if you get results via E-mail.
If you sent a query by E-mail and get the result by E-mail, you have valid results.
Services: ddbj Keywords:

Agrobacterium tumefaciens was added to GIB

August 17,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of Agrobacterium tumefaciens was released, we incorporated it to GIB, and now you can search those data.
Reference: Complete Genome Sequence of Agrobacterium tumefaciens C58 (Rhizobium radiobacter C58), the Causative Agent of Crown Gall Disease in Plants, Unpublishe
Services: ddbj Keywords:

Shinorhizobium meliloti was added to GIB

August 10,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of Shinorhizobium meliloti was released, we incorporated it to GIB, and now you can search those data.
Analysis of the chromosome sequence of the legume symbiont Sinorhizobium meliloti, Unpublished
Services: ddbj Keywords:

PIR rel. 69 was released

August 09,2001
PIR Rel. 69 was released on Aug. 9, 2001 at DDBJ. PIR Rel.69 consists of 232,624 entries, and the total number of residues reached 80,607,033 aa.
Services: ddbj Keywords:

Arbidopsis thaliana was added to GIB

August 07,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
GIB is now not only for microbes but also Arbidopsis thaliana. The genome sequence of Arabidopsis thaliana is retirievable in the Genome Information Broker (GIB)
Services: ddbj Keywords:

DAD rel. 16 was released

August 03,2001
DDBJ amino acid database (DAD) Release 16 was released on Aug. 3rd, 2001 at DDBJ. DAD Release 16 consists of 797,764 entries, and the total number of residues reached 245,236,540.
Services: ddbj Keywords:

Clostidium acetobutylicum was added to GIB

July 31,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Clostidium acetobutylicum was released, we incorporated it to GIB, and now you can search those data.
Genome Sequence and Comparative Analysis of the Solvent-Producing BacteriumClostridium acetobutylicum, J. Bacteriol. 183 (16), 4823-4838 (2001)
Services: ddbj Keywords:

The DDBJ release is now available also in XML

July 25,2001
DDBJ now applied XML not only to entry by entry but also to the whole release in July 2001. XML formatted files of DDBJ release 46 (July 2001) can be retrieved through the following anonymous FTP:
DDBJ Release in XML
Copyright 2001 National Institute of Genetics, Center for
Information Biology and DNA Data Bank of Japan. No reproduction or republication in any form without written permission.

Miyazaki S and Sugawara H, "Development of DDBJ-XML and its application to a database of cDNA" , Genome Informatics 2000, Universal Academy Press, Inc (Tokyo), 380-381, 2000
Miyazaki S and Sugawara H, "Visualization of features in flat file by use of DDBJ-XML", Currents in Computational Molecular Biology 2001 (Montreal), 249-250, 2001
Services: ddbj Keywords:

Streptococcus pneumoniae was added to GIB

July 25,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Streptococcus pneumoniae was released, we incorporated it to GIB, and now you can search those data.
Reference: Complete Genome Sequence of a virulent isolate of
Streptococcus pneumoniae, Science 293 (5529), 498-506 (2001)
Services: ddbj Keywords:

Updates of "Conference on information biology"

July 25,2001
The Fourth International Workshop on Advanced Genomics From Genomics to Proteomics (November 13-14, 2001) was added to "Conference on information biology".
Services: ddbj Keywords:

DDBJ Rel. 46 Completed

July 17,2001
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media. We completed DDBJ Release 46 in Jul. 2001.
DDBJ Release 46 consists of 12,313,759 entries, and the number of bases reached 13,037,646,166.
Services: ddbj Keywords:

DDBJ/CIB Human Genomics Studio service reopening

July 16,2001
We reopened "DDBJ/CIB Human Genomics Studio" service.We appreciate your cooperation.
Services: ddbj Keywords:

DAD rel. 20 was released

June 26,2001
DDBJ amino acid database (DAD) Release 20 was released on June 26, 2002 at DDBJ. DAD Release 20 consists of 1,062,430 entries, and the total number of residues reached 325,626,765.
Services: ddbj Keywords:

Minerva periodic maintenance

June 14,2001
Minerva service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Jun. 22, 2001 (Fri) 12:00-21:00
Services: ddbj Keywords:

supernig periodic maintenance

June 14,2001
Supernig service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Jun. 22, 2001 (Fri) 16:00-21:00
Services: ddbj Keywords:

Thermoplasma volcanium was added to GIB

June 07,2001
GIB (Genome Information Broker for Microbial Genomes)
provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Thermoplasma volcanium was released, we incorporated it to GIB, and now you can search those data.
Reference: Determination of the complete genomic DNA sequence
of Thermoplasma volcanium, Proc. Natl. Acad. Sci. U.S.A. 97, 14257-14262 (2000)
Services: ddbj Keywords:

Mesorhizobium loti was added to GIB

May 31,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Mesorhizobium loti was released, we incorporated it to GIB, and now you can search those data.
Reference: Complete genome structure of the nitrogen-fixing symbiotic bacterium Mesorhizobium loti., DNA Res. 7, 331-338 (2000)
Services: ddbj Keywords:

Updates of "Conference on information biology"

May 25,2001
The 2001 Annual Meeting of the CBI Society (July 25-27, 2001), The 8th International Congress on Endocytobiology and Symbiosis (October 12-17, 2001) and Evolutionary Genomics - New Paradigm of Biology in the 21st Century (November 4-6, 2001) were added to "Conference on information biology".
Services: ddbj Keywords:

Updates of "Conference on information biology"

May 24,2001
Artificial Intelligence and Heuristic Methods for Bioinformatics (October 1-11, 2001) was added to "Conference on information biology".
Services: ddbj Keywords:

Mycoplasma pulmonis was added to GIB

May 22,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Mycoplasma pulmonis was released, we incorporated it to GIB,and now you can search those data.
Reference: The complete genome sequence of the murine respiratory pathogen Mycoplasma pulmonis, Nucleic Acids Res. 29(10), 2145-2153(2001)
Services: ddbj Keywords:

PIR rel. 68 was released

May 21,2001
PIR Rel. 68 was released on May 21, 2001 at DDBJ. PIR Rel.68 consists of 219,241 entries, and the total number of residues reached 76,174,552 aa.
Services: ddbj Keywords:

Updates of "Conference on information biology"

May 16,2001
The Ribosome (May 31-June 5, 2001),
Mechanisms of Cell Death and Disease:Advances in Therapeutic Intervention (June 2-5, 2001) , Bioinformatics Tools for Comparative Genomics (June 11-15, 2001) andPharmaConference '01 (August 5-9, 2001) were added to "Conference on information biology".
Services: ddbj Keywords:

DAD rel. 19 was released

May 15,2001
DDBJ amino acid database (DAD) Release 19 was released on May 15, 2002 at DDBJ. DAD Release 19 consists of 1,012,203 entries, and the total number of residues reached 309,708,601.
Services: ddbj Keywords:

Staphylococcus aureus Mu50,Sulfolobus solfataricus and Mycobacterium tuberculosis CDC1551 were added to GIB

May 14,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the following genome sequencedata were released, we incorporated them to GIB,and now you can search those data.
Staphylococcus aureus Mu50

Whole genome sequencing of methicillin-resistant Staphylococcus aureus, the major hospital pathogen, Lancet 357, 1225-1240 (2001)
University of Tsukuba College of Medical Technology and Nursing

Sulfolobus solfataricus

Copenhagen University

Mycobacterium tuberculosis CDC1551

Whole genome comparison of Mycobacterium tuberculosis clinical and laboratory strains, Unpublished
The Institute for Genomic Research
Services: ddbj Keywords:

DDBJ introduced XML

May 11,2001
DDBJ introduced XML for the data dissemination and named it DDBJ-XML. XML format is firstly implemented into a DDBJ search program named "getentry".
You could choose XML format from a pull-down menu of "getentry".
You could also find a link to the DTD file when you get the result of "getentry".
Miyazaki, S and Sugawara, H, "Development of DDBJ-XML and Its Application to a Database of cDNA" , Genome Informatics 2000, Universal Academy Press, Inc (Tokyo),380-381,2000
Satoru Miyazaki and Hideaki Sugawara,"Visualization of Features in Flat file by use of DDBJ-XML", Currents in computational molecular biology 2001(Montreal), 249-250, 2001
Services: ddbj Keywords:

DAD Rel.15 was released

April 27,2001
DDBJ amino acid database (DAD) Release 15 was released on Apr. 26th, 2001 at DDBJ. DAD Release 15 consists of 741,845 entries, and the total number of residues reached 228,137,184.
Services: ddbj Keywords:

Staphylococcus aureus was added to GIB

April 26,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Staphylococcus aureus was released, we incorporated it to GIB,and now you can search those data.
Reference: Whole genome sequencing of meticillin-resistant Stapylococcus aureus, The Lancet 357, 1225-1240 (2001)
Services: ddbj Keywords:

supernig periodic maintenance

April 23,2001
suprenig service will be unavailable during the following date because of the periodic maintenance and upgrade of Operating system (Solaris8). In connection with Upgrade of Operating system, recompilation may be needed with a part of program.
Thank you very much for your understanding and cooperation.
9:00 a.m, Monday May 7 - 9:00 a.m, Thursday May 10
Services: ddbj Keywords:

DDBJ Rel. 45 Completed

April 17,2001
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media. We completed DDBJ Release 45 in Feb. 2001. DDBJ Release 45 consists of 11,434,113 entries, and the number of bases reached 12,207,092,905. From the present release, we include a new division, HTC (High Throughput cDNA).
Services: ddbj Keywords:

Streptococcus pyogenes was added to GIB

April 16,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Streptococcus pyogeneswas released, we incorporated it to GIB,and now you can search
those data.
Reference: Complete genome sequence of an M1 strain of Streptococcus pyogenes., Proc. Natl. Acad. Sci. U.S.A. 98 (8), 4658-4663 (2001)
Services: ddbj Keywords:

minerva (VPP5000) periodic maintenance

April 16,2001
minerva (VPP5000) service will be unavailable during the following date because of the periodic maintenance. Thank you very much for your understanding and cooperation.
Apr. 20th, 2001 (Fri) 12:00-21:00
Services: ddbj Keywords:

CIB renamed CIB/DDBJ

April 06,2001

The Center for Information Biology (CIB) of the National Institute of Genetics (NIG) changed its name to "the Center for Information Biology and DNA Data Bank of Japan (CIB/DDBJ)" in April 2001. Since DDBJ began its operations in 1986, it had been regarded as a project of the DNA Research Center and then as a project of CIB. Now DDBJ is officially recognized as an organization of NIG, and continues its activities as ever.
Services: ddbj Keywords:

Updates of "Conference on information biology"

April 04,2001
Antisense 2001 (May 21-22, 2001), Beyond Genome 2001 (June 17-22, 2001) and 13th International Genome Sequencing and Analysis Conference
(October 25-28, 2001) were added to "Conference on information biology".
Services: ddbj Keywords:

Caulobacter crescentus was added to GIB

March 27,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Caulobacter crescentus was released, we incorporated it to GIB,and now you can search those data.
Services: ddbj Keywords:

Announcement of temporary shutdown of the DDBJ web home page

March 26,2001
Web homepage of DDBJ will have temporary shutdown during the following date due to server maintenance.
You cannot access DDBJ web homepage (http://www.ddbj.nig.ac.jp/) during that period. Thank you very much for your understanding and cooperation.
March 29 (Thu), 2001 10:00am - 12:00
Services: ddbj Keywords:

Updates of "Conference on information biology"

March 26,2001
WABI 2001 (August 28-31, 2001)
were added to "Conference on information biology".
Services: ddbj Keywords:

Mycobacterium leprae was added to GIB

March 05,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.Because the genome sequencedata of Mycobacterium leprae was released, we incorporated it to GIB,and now you can search those data.
Services: ddbj Keywords:

Updates of "Conference on information biology"

February 20,2001
SMBE 2001 ANNUAL MEETING (July 7-10, 2001) was added to "Conference on information biology".
Services: ddbj Keywords:

Publication of human genome draft sequences

February 19,2001
Article on human genome draft sequences was published in Nature, February 15 (vol. 409, pp. 860-921) by International Human Genome Sequencing Consortium. Public research institutions in USA, United Kingdom, Japan, France, Germany, and China consist of this international Consortium. Human Genome Research Group at RIKEN Genomic Sciences Center (Project Director: Sakaki Yoshiyuki) and research group of Professor Shimizu Nobuyoshi at Department of Molecular Biology, Keio University School of Medicine are involved in this International Consortium from Japan. GenBank/NCBI, EMBL/EBI, and DDBJ/CIB, which are constructing and maintaining nucleotide sequence database through international collaboration, were also mentioned at the end of this paper.
Announcement was made in last June at White House on the completion of this human genome draft sequences, followed by improvement of sequence quality and biological analyses. All the efforts produced Nature paper and Science paper (vol. 291, pp. 1304-1351) by Celera Genomics. As written at the beginning of Nature paper, 100 years after the rediscovery of Mendel's laws of heredity, we human beings reached the fundamental level of our own genetic information in which no further details cannot be described. This achievement also has a great significance as the starting point of Biology in the 21st Century.
International Human Genome Sequencing Consortium had simultaneous press releases worldwide prior publication of Nature paper on February 12. In Japan, director Wada Akiyoshi, project director Sakaki Yoshiyuki, and team leader Fujiyama Asao of RIKEN Genomic Sciences Center, professor Shimizu Nobuyoshi and associate professor Minoshima Nobuo of Keio University School of Medicine, and professor Sugawara Hideaki of Center for Information Biology, National Institute of Genetics attended the press release. Professor Sugawara represented DNA Data Bank of Japan (DDBJ), and Dr. Fujiyama is at Department of Human Genetics, National Institute of Genetics.

Following results through genomic analyses (from Nature paper) enhance our intellectual curiosity such as evolution of our own species, variety of humanbiological phenomena.
  • The genomic landscape shows marked variation in the distribution of a number of features, including genes, transposable elements, GC content, CpG islands and recombination rate. This gives us important clues about function. For example, the developmentally important HOX gene clusters are the most repeat-poor regions of the human genome, probably reflecting the very complex coordinate regulation of the genes in the clusters.
  • There appear to be about 30,000 to 40,000 protein-coding genes in the human genomeonly about twice as many as in worm or fruit fly. However, the genes are more complex, with more alternative splicing generating a larger number of protein products.
  • The full set of proteins (the `proteome') encoded by the human genome is more complex than those of invertebrates. This is due in part to the presence of vertebrate-specific protein domains and motifs (an estimated 7% of the total), but more to the fact that vertebrates appear to have arranged pre-existing components into a richer collection of domain architectures.
  • Hundreds of human genes appear likely to have resulted from horizontal transfer from bacteria at some point in the vertebrate lineage.
  • Although about half of the human genome derives from transposable elements, there has been a marked decline in the overall activity of such elements in the hominid lineage. DNA transposons appear to have become completely inactive and long-terminal repeat (LTR) retroposons may also have done so.
  • The mutation rate is about twice as high in male as in female meiosis.
  • Recombination rates tend to be much higher in distal regions of chromosomes and on shorter chromosome arms in general, in a pattern that promotes the occurrence of at least one crossover per chromosome arm in each meiosis.
  • More than 1.4 million single nucleotide polymorphisms (SNPs) in the human genome have been identified.

All nucleotide sequence data determined by International Human Genome Sequencing Consortium are open from DDBJ/EMBL/GenBank International Nucleotide Sequence Database. We DDBJ show those sequence entries either in HTG or HUM division of the DDBJ database. Chromosome-wise human sequence data can be retrieved from downloading site of the DDBJ/CIB Human Genomics Studio.

Nucleotide sequence data released by International Human Genome Sequencing Consortium and those determined by Celera Genomics differ. For example, International Consortium covered human genome by small number of long contigs, while Celera did by many short contigs. Results of sequence analyses also differ, probably caused by use of different material (individual difference), by difference on nucleotide sequence determination and way of data analyses.

However, data produced by Celera Genomics are not released through public databases, but from the company server with usage limitation. Many protests, including that by Science Council of Japan, were made againt this situation, because this kind of activity may cause loss of reproducibility that must be assured in scientific papers, and because this will lead to fragmentation of database important for biological studies.

Although such political issues remain, when the whole nucleotide sequences of the human genome is obtained within 2-3 years, this will become a great achievement not only of biology but of modern civilization. We, DNA Data Bank of Japan (DDBJ), have an important responsibility to construct database in this international enterprise, and will expand our efforts. We expect your continuous cooperation.

Services: ddbj Keywords:

Updates of "Conference on information biology"

February 14,2001
Genome Japan (March 26-27, 2001) and Genome Informatics Workshop 2001 (December 18-19, 2001) were added to "Conference on information biology".
Services: ddbj Keywords:

DAD Rel.14 and PIR Rel.67 were released

February 13,2001
DDBJ amino acid database (DAD) Release 14 and PIR Release 67 were released on Feb. 9th, 2001 at DDBJ.
DAD Release 14 consists of 662,374 entries, and the total number of residues reached 205,640,609.PIR Release 67 consists of 198,801 entries, and the total number of residues reached 68,722,935.
Services: ddbj Keywords:

Updates of "Conference on information biology"

February 09,2001
RECOMB Satellite Meeting on DNA Sequence Assembly (May 19-20, 2001), Fifth Annual Conference On Computational Genomics (November 29-December 1, 2001) and Pacific Symposium on Biocomputing 2002 (January 3-7, 2002) were added to "Conference on information biology".
Services: ddbj Keywords:

19,168 full-length mouse cDNAs with function annotation have been made public

February 08,2001
Sequences of Mus musculus cDNA (full-length, with annotation on their function) have been submitted to DDBJ by Dr. Y. Hayashizaki (Project Director)'s team at the RIKEN (Institute of Physical and Chemical Research) Genomic Sciences Center. We assigned accession numbers AK002213-AK018700 (16,454 entries), AK018701-AK021412 (2,712 entries) , AK027261-AK027262 (2 entries) to these sequences, and released them in the HTC division of the DDBJ/EMBL/GenBank International Nucleotide Sequence Database.The sequences were also published in Nature 409, 685-690 (8/2/2001).
Services: ddbj Keywords:

Pasteurella multocida and Lactococcus lactis were added to GIB

February 05,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences. Because the genome sequencedata of Pasteurella multocida and Lactococcus lactis were released, we incorporated them to GIB,and now you can search those data.
Services: ddbj Keywords:

E.coli O157:H7 was added to GIB

February 05,2001
GIB (Genome Information Broker for Microbial Genomes) provides a comprehensive view of the complete microbial genome sequences.
Because the genome sequencedata of E.coli O157:H7 was released, we incorporated it to GIB,and now you can search those data.
Services: ddbj Keywords:

Renewal of DDBJ WWW Home Page

February 01,2001
We started web home page of DDBJ in December 1994, and this web server include many services such as "Data Submission" and"Database Search and Analysis".
We renewed our home page in the end of January. The basic color is navy blue and headlines were divided into two. There are link buttons to major items in the left side. Key word search, site map, and jump button are also available in this new system. The URL is
[http://www.ddbj.nig.ac.jp/]. (not changed) ["Other Databases moved to "Links to information biology databases".]
Services: ddbj Keywords:

DDBJ Rel. 44 Completed

January 31,2001
The nucleotide sequence database collected and maintained by DDBJ is quarterly released online to the public and distributed in the magnetic media. We completed DDBJ Release 44 in Jan. 2001.
DDBJ Release 44 consists of 10,165,597 entries, and the number of bases reached 11,136,298,841.
Services: ddbj Keywords:

Updates of "Conference on information biology"

January 31,2001
The 6th International Symposium on Genome Science in the 21st Century (March 14-17, 2001) was added to "Conference on information biology".
Services: ddbj Keywords:

LIBRA I updates

January 30,2001
A computer application of threading:
LIBRA I was improved. Structural library of LIBRA was enlarged to about 3,000 structures
Services: ddbj Keywords:

Supernig system shutdown due to hardware replacement

January 30,2001
We at NIG are going to replace the computer system VPP500 with VPP5000 in order to catch up with the steep increase in the DNA data and the various needs of research today. We are also going to introduce a new server (PrimePower M2000).
Accordingly, we will stop the supernig system as follows.
We appreciate your understanding and cooperation.

-  The system (front end processor) is scheduled to be shutdown from Feb. 12 to Feb. 15.
¡¡ The new system is scheduled to start on Friday, Feb. 16.¡ÊDetail¡Ë
-  The system (back end processor) is scheduled to be shutdown from Feb. 12 to Feb. 25.
¡¡The new system is scheduled to start on Feb. 26 (Mon.).¡ÊDetail¡Ë

Services: ddbj Keywords:

Announcement of temporary shutdown of the DDBJ web home page

January 26,2001
Web home page of DDBJ will have temporary shutdown due to its server exchange.
Scheduled shutdown time is 15:00 - 16:00, Monday, January 29.
You cannot access DDBJ web homepage ( http://www.ddbj.nig.ac.jp/) during that time period. This sever change is coupled with major change of web home page.
Thank you for your understanding and cooperation.
Services: ddbj Keywords:

Updates of "Conference on information biology"

January 26,2001
GEMINI - Genes and Minds Initiative: Workshop on Ape Genomics (March 14-15, 2001) was added to "Conference on information biology".
Services: ddbj Keywords:

DDBJ will stop accepting submissions by 'Authorin' and 'Submission Form' Jan. 25, 2001

January 25,2001
DDBJ is now developing a new data management system to cope more efficiently with a large amount of incoming data. The new data management system is expected to be in operation from April 1st, 2001.
Since the new system no longer accommodates data presented in 'Authorin' or 'Submission Form', DDBJ will stop accepting data in those two forms from April 1st, 2001.
Please use the WWW submission tool, SAKURA instead of the two forms.
Thank you very much for your understanding and cooperation.
Services: ddbj Keywords:

Supernig periodic maintenance

January 12,2001
Supernig service will be unavailable during the following date because of the periodic maintenance.
Thank you very much for your understanding and cooperation.
Jan. 19, 2001 (Fri) 12:00 - 21:00
Services: ddbj Keywords:

Updates of "Conference on information biology"

January 10,2001
5th evolutionary biology meeting (June 27-29, 2001) was added to "Conference on information biology".
Services: ddbj Keywords:
  • Partners

  • NIG logo
  • ROIS logo
  • JBI logo
  • NBDC logo
  • DBCLS logo
  • PDBj logo