Please send your request to DDBJ with the following contents in clear English.
To : ![]()
- Accession numbers:
- The modified part:
- Total base count:
- Other modified feature:
- Updated sequence in full length: Please use the following format.
>AB******1 aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc // >AB******2 aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc aaaaaaaaaat //- Header line; starts with “>”, followed by the accession number at the head of each sequence.
- Sequence; each line must be 60 letters or less.
- End line; end flag, “//”, must be at the end of each sequence.