Make Sra Error
constraint violated while executing function within virtual database module
Read names are possibly not unique in Run.
Please see the FAQ: How are my data files processed? and revise duplicated read names if there.
path not found while accessing directory within file system module - no message text available
Files are not recognized. This error occurs in the following cases:
- filename contains whitespace
- files are in sub-directories
- fastq files are tar archived
CheckSum Error
The MD5 values in the Run metadata are different from those of the uploaded files. Please check the followings.
Check whether the MD5 values of the files in your local computer match those entered in the Run metadata or not.
- If the MD5 values in the Run metadata are not correct, revise the values in the metadata.
- If those values match, corresponding uploaded files may be corrupted during file transfer, so please re-upload the files.
File Name Error
Undefined or File not found: @SQ SN:
Please upload the SN-reference mapping table files to the directory.
See the Data Files for details.
Metadata XML registration
When registering metadata XML files whose SPOT_DESCRIPTOR elements have been added or modified, following errors may occur.
Reads having no application read
Read composition
| Read Index : | 0 | 1 |
| Read : | ATCCGG | CATCAGTTGAT………………………………………………… |
| Base Coordinate : | 1 | 7 50 |
| Read Type : | Primer | Linker (should have at least one application) |
Reads with inconsistent base coordinate
Read 1 composition
| Read Index : | 0 | 1 |
| Read : | ATCCGG…………… | CATCAG…………… |
| Base Coordinate : | 1 | 1 (should be > 1) |
| Read Type : | Forward | Reverse |
Read 2 composition
| Read Index : | 0 | 1 | 2 |
| Read : | TCAG | ATAGAGTTG……… | TCGTATAACTTCGTATAATGTATGCTATACGAAGTT |
| Base Coordinate : | 1 | 5 | 4 (should be > 5) |
| Read Type : | Adapter | Forward | Reverse |
Read 3 composition
| Read Index : | 0 | 1 |
| Read : | ATCCGGGTGTGTCATCAG | CATCAG…………… |
| Base Coordinate : | 2 (should start at 1) | 19 |
| Read Type : | Adapter | Forward |
Reads with relative order which cannot be specified
Read composition
| Read Index : | 0 | 1 | 2 | 3 |
| Read : | TCAG | ATAGA…………… | ………………… | CTCAT………………………………………………………… |
| Base Coordinate : | 1 | 5 | ||
| Read Type : | Adapter | Forward | Linker | Forward (This forward cannot be specified) |
Spot (Read Spec) metadata
| Read Index | Read Class | Read Type | Ordering Method |
|---|---|---|---|
| 0 | Technical Read | Adapter | BaseCoord = 1 |
| 1 | Application Read | Forward | BaseCoord = 5 |
| 2 | Technical Read | Linker | RelativeOrder |
| 3 | Application Read | Forward | RelativeOrder |