CLUSTALW is the program for multiple alignment and tree-making. DDBJ released an extended version of CLUSTALW on Dec. 7, 2001. The extended options are as follows:
- When you specify ALIGN "on" for multiple alignments, dot option is available. In this description, identical part of the sequences are indicated as dot (see example).
- When you specify TREE "on" to reconstruct a phylogenetic tree from nucleotide sequences, as a method for estimation of a genetic distance, Tamura, Tajima-Nei, Gojobori-Ishii-Nei 6-parameter and Tamura-Nei as well as Jukes-Cantor and Kimura 2-parameter, can be selected. 
example : CLUSTAL W (1.81) multiple sequence alignment A1-1_A101      GGCCGACCCTTCGGCCCGGGGGCCA1-2_A102      ......T.................A1-3_A103      NNNN..T.T...............A1-4_A104      NNNN.G..................A2             NNNN..T................-AX             NNNN......A.............A3-1           NNNN................A...cis-AB         NNNN..T...........C.....O-1_O101       ....-...................O-2_O201       TATT-G....A.A..T...A....O-3            NNNN.G.G.........A......O-4_O102       NNNN-....C..............O-5_O103       NNNN-G..................O-6_O202       NNNN-.....A.A..T...A....O-7_O203       NNNN-G....A.A.TT...A....B-1_B101       .....G.G...T.A..A.C..A..B-2_B102       NNNN.G.G...T.A..A.C.....B-3_B103       NNNN.G.G.....A..A.C..A..B(A)           NNNN.G.G........A.C..A..B3-1           NNNN.G.G...T.A..A.C..AT.               ************************