• Revision of the Terms of Use (Access and Benefit-Sharing)

WABI BLAST (Tentative closing)

  • Home
  • services
  • WABI BLAST (Tentative closing)

Overview

WABI provides web APIs for using BLAST.

  • A search job is registered in a queue by submitting a BLAST search criteria. A Request ID is returned as response data.
    Once a search job is registered in the queue, the state of the job transitions from “Waiting” ==> “Executing” ==> “Completed”.
    Once the status of a job moves to the “Completed” state, the corresponding search results will be available for viewing. Results are retained on the server and can be viewed for up to 7 days after the search has been executed.
    (Refer to “Search result retention period” 「Request ID and BLAST result」 )
  • Returns the status of the BLAST search for a specified Request ID.
  • Returns the BLAST search criteria for a specified Request ID.
  • Returns the BLAST search result for a specified Request ID.

Searching WABI BLAST

BLAST search job

A BLAST search job is first registered in the queue of jobs awaiting execution. The job is then executed as soon as computing resources become free.

See Also: Search job status

Search Job Status

WABI search jobs transition through the following status.

Job Status Explanation
waiting The job has been added to the queue, but has not yet commenced execution.
running The job is being executed.
finished The job has completed execution.
not-found The job with the specified Request ID does not exist.

Example response values when querying job status:

1 request-ID: wabi_blast_1111-1111-1111-11-111-111111
2 status: finished
3 current-time: 2013-01-01 12:34:56
4 system-info:
5 stdout

1 {
2         "request-ID": "wabi_blast_1111-1111-1111-11-111-111111",
3         "status": "finished",
4         "current-time": "2013-01-01 12:34:56",
5         "system-info": "nstdout" 
6 }
1 <?xml version="1.0" ?>
2 <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
3 <result>
4   <request-ID>wabi_blast_1111-1111-1111-11-111-111111</request-ID>
5   <status>finished</status>
6   <current-time>2013-01-01 12:34:56</current-time>
7   <system-info>stdout</system-info>
8 </result>
 1 {
 2         "error-message": "Unexpected error (status == null)",
 3         "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
 4         "jobId": "123456",
 5         "month": "01",
 6         "day": "01",
 7         "hour": "12",
 8         "min": "34",
 9         "sec": "56",
10         "millisec": "789",
11         "randomId": "987654" 
12 }

BLAST search criteria

Example of parameters that are passed on when a BLAST job is submitted using WABI.

Example:

 1 {
 2         "address": "",
 3        "database": "hum",
 4         "datasets": "ddbjall",
 5         "format": "json",
 6         "parameters": " -v 100 -b 100 -e 10 -F F -W 11",
 7         "program": "blastn",
 8        "querySequence": ">my query sequence 1nCACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAAnGCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTGnGTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCACn",
 9        "result": "www" 
10 }

BLAST search result

The following is an example of the BLAST search output. This is the same as the file generated using the blastall command, when executed using the “-o” command line option.

Example:

 1 BLASTN 2.2.25 [Feb-01-2011]
 2 
 3 Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
 4 Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
 5 "Gapped BLAST and PSI-BLAST: a new generation of protein database search
 6 programs",  Nucleic Acids Res. 25:3389-3402.
 7 
 8 Query= AB000095|AB000095.1 Homo sapiens mRNA for hepatocyte growth
 9 factor activator inhibitor, complete cds.
10          (1740 letters)
11 
12 Database: hum
13            572,091 sequences; 5,019,832,159 total letters
14 
15 Searching..................................................done
16 
17                                                                  Score    E
18 Sequences producing significant alignments:                      (bits) Value
19 
20 AB000095|AB000095.1 Homo sapiens mRNA for hepatocyte growth fact...  3449   0.0
21 BC018702|BC018702.1 Homo sapiens serine peptidase inhibitor, Kun...  3435   0.0
22 BC004140|BC004140.1 Homo sapiens serine peptidase inhibitor, Kun...  3190   0.0
23 BT007425|BT007425.1 Homo sapiens serine protease inhibitor, Kuni...  3053   0.0
24 AY358969|AY358969.1 Homo sapiens clone DNA35880 HAI-1 (UNQ223) m...  2145   0.0
25 AY296715|AY296715.1 Homo sapiens hepatocyte growth factor activa...  1984   0.0
(後略)
        

BLAST search result image

BLAST search jobs submitted using WABI generate a graphical display of the search output.

Example:

Detail view_6_1

WABI BLAST usage examples

Code example using Java

Example of code

Example.java
blast_condition.fasta
>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
blast_condition.txt
Code
datasets        ddbjall
database        hum
program blastn
parameters      -v 100 -b 100 -e 10 -F F -W 11
format  json
result  www
pom.xml

Execution example

Preliminary preparation (Please run first)
$ wget 'http://sourceforge.jp/frs/redir.php?m=iij&f=%2Fjsonic%2F56583%2Fjsonic-1.3.0.zip'
$ unzip jsonic-1.3.0.zip
$ mv jsonic-1.3.0/jsonic-1.3.0.jar src/main/resources/
$ tree -F
.
├── blast_condition.fasta
├── blast_condition.txt
├── pom.xml
└── src/
└── main/
    ├── java/
    │   └── Example.java
    └── resources/
        └── jsonic-1.3.0.jar
Build
$ mvn clean
$ mvn compile
$ mvn package
$ mvn assembly:assembly -DdescriptorId=jar-with-dependencies
Execution procedure
$ java -classpath 'target/wabi-client-1.jar:target/wabi-client-1-jar-with-dependencies.jar:src/main/resources/jsonic-1.3.0.jar' Example

« Close

Code example using Perl

Example of code

example.pl
blast_condition.fasta
>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
blast_condition.txt
Code
datasets        ddbjall
database        hum
program blastn
parameters      -v 100 -b 100 -e 10 -F F -W 11
format  json
result  www

Execution example

Preliminary preparation (Please run first)
$ cpan
cpan[1] install JSON
cpan[2]> install HTTP::Request::Common
cpan[3]> install LWP::UserAgent
cpan[4]> install HTTP::Status
cpan[5]> quit
$ tree -F
.
├── blast_condition.fasta
>├── blast_condition.txt
└── example.pl
Execution procedure
$ perl example.pl

« Close

Code example using Ruby

Example of code

example.rb
blast_condition.fasta
>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
blast_condition.txt
Code
datasets        ddbjall
database        hum
program blastn
parameters      -v 100 -b 100 -e 10 -F F -W 11
format  json
result  www

Execution example

Execution procedure
$ ruby example.rb
Actual example

Example of the execution result

wabi_blast_2013-0606-1336-31-681-634313.txt

« Close

WABI BLAST Details

URI POST /blast (submit a search job)

This method appends a BLAST search to the job queue and returns the Request ID.
The BLAST search criteria, method for notifying the result, and other options are specified using HTTP parameters.

Item Description
HTTP Method POST
URI /blast
HTTP Parameters querySequence Search sequence data in multi-FASTA format
example: >my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC

Note: Increasing the number of sequences will not increase the degree of parallel processing.
We recommend reducing the number of sequences searched for the web API, as this will better balance the load on the job management engine.
datasets Dataset (example: "ddbjall")
database database (example: "hum", "hum pri")
program BLAST program (example: "blastn")
parameters Other options (example: "-v 100 -b 100 -e 10 -F F -W 11")
format response data format (example: "text", "json")
result result retrieval method (example: "www", "mail")
address Email address
Request action Add a new BLAST search job to the queue for processing.
HTTP Response If successful Request ID
If failed HTTP status 4xx

Server-side processing flow

  1. Check validity of input values.
    If an invalid input value is found, then the processing is interrupted and HTTP status 400 Bad Request is returned.
  2. Add the BLAST search into the job queue.
  3. Information about the job added to the queue is returned using the specified format.
    If the specified format is not available, then HTTP status 404 Not Found is returned.

Input validation check performed

datasets
(optional)
  • Causes an input validation error if an undefined value is specified.
    Note: Currently not used. Consistency check between the database is not performed.
database
  • Required value.
  • Database names must be separated by spaces; otherwise, the check will cause an input validation error. Database names must comprise only alphabets and underscore "_".
    example: "hum", "hum pri" and so on.
program
  • Required value.
  • Causes an input validation error if an undefined value is specified.
format
  • Required value.
  • Causes an input validation error if an undefined value is specified.
parameters
(optional)
  • Causes an input validation error unless options and corresponding values are listed using space as separators.
  • Causes an input validation error if invalid options are specified. A valid option depends on the specified program, as follows:
    • In case program value is "megablast" :
      Options must be one or more of ADEFGHIJLMNPRSTUVWXYZbefglmnpqrstvyz; other options will cause an input validation error.
      example: "-A" is a valid option, but "-B" will cause an input validation error.
    • For all other program values:
      Options must be one or more of ABCDEFGIJKLMPQSTUVWXYZbefglmnqrstvwyz; other options will cause an input validation error.
      example: "-B" is a valid option, but "-H" will cause an input validation error.
  • Option values can be a numeric value, alphanumeric characters, or comma-separated alphanumeric characters.
    example: "-1", "foo, bar", etc.
result
  • Required value.
  • Causes an input validation error if an undefined value is specified.
address
  • Requires value if the value of result is "mail".
  • Only a valid email address is permitted. Other values will cause an input validation error.

Response data

In the case of successful completion:
  • A “successful” HTTP status code such as 200 will be returned.
  • The field requestId will contain Request ID.
  • Other values such as current-time and other request information may be included in the response data; however, formatting of these values may change in the future.
    Please use the HTTP status code to determine the success or failure of the request.
In the case of failed completion:
  • A “client error” HTTP status code such as 400 will be returned.
  • The key called error-messages included in the returned data will contain an error message indicating information such as the name of the parameter that caused input validation error.
  • Other values including the cause of the error and other request information may be included in the returned data; however, formatting of these values may change in the future.
    Please use the HTTP status code to determine the success or failure of the request.

Example request and response

Examples of input data

HTTP Parameter Input Value
address ""
database "hum"
datasets "ddbjall"
format "json"
parameters " -v 100 -b 100 -e 10 -F F -W 11"
program "blastn"
querySequence
>my query sequence 1
    CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
    GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
    GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
result "www"

Example response for a successfully completed request

HTTP Status 200
 1 {
 2        "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
 3        "program": "blastn",
 4        "datasets": "ddbjall",
 5        "database": "hum",
 6        "parameters": " -v 100 -b 100 -e 10 -F F -W 11 ",
 7        "current-time": "2013-01-01 12:34:56",
 8        "start-time": "",
 9        "current-state": "" 
10 }
HTTP Status 200
 1 <?xml version="1.0" ?>
 2 <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
 3 <result>
 4   <requestId>wabi_blast_1111-1111-1111-11-111-111111</requestId>
 5   <program>blastn</program>
 6   <datasets>ddbjall</datasets>
 7   <database>hum</database>
 8   <parameters> -v 100 -b 100 -e 10 -F F -W 11 </parameters>
 9   <current-time>2013-01-01 12:34:56</current-time>
10   <start-time></start-time>
11   <current-state></current-state>
12 </result>

Example response data when there is an input validation error

HTTP Status 400
 1    {
 2    "status": "illegal-arguments",
 3    "message": "Illegal arguments.",
 4    "format": null,
 5    "program": "blastn",
 6    "datasets": "ddbjall",
 7    "database": "hum",
 8    "parameters": null,
 9    "querySequence": ">my query sequence 1nCACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAAnGCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTGnGTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCACn",
10    "result": "",
11    "address": null,
12    "current-time": "2013-01-01 12:34:56",
13    "error-messages": [
14        "Required: (result)" 
15    ],
16    "error-message": "BAD_REQUEST (null)" 
17    }

Usage Example

Example of the use of the REST client on Java Spring Framework:

« Close

URI GET /blast/{Request-ID}?info=status (query the status of a search job)

Returns the status of the job specified by Request ID.

Item Description
HTTP Method GET
URI "/blast/" + Request ID + HTTP Parameter (example: "/blast/wabi_blast_1111-1111-1111-11-111-111111?info=status")
HTTP Parameters info (default value = "status") Job information type (example: "status", "result")
format (default value = "text") Response data format (example: "text", "json")

Server-Side Processing Flow

  1. Input values are validated on the server side.
    If an input validation error is found, processing is interrupted, and the server returns HTTP status 400 Bad Request.
  2. The server obtains job information corresponding to the specified Request ID and returns the current status.
    HTTP status code 404 is returned if the search retention period has expired or if the job information cannot be found.
  3. The server returns the obtained current job’s status using the specified format.
    However, the server returns HTTP status 404 Not Found if the specified format is invalid.

Input value validation check performed

requestId
  • Required value.
  • Values containing any characters other than alphanumeric, "-", and "_" will cause an input validation error.
  • Any Request ID that does not exist will cause an input validation error.
    Search results are discarded after a given period; it will be considered to be an input validation error in this case as well.
format
  • Required value.
  • Causes an input validation error if an undefined value is passed.
imageId
  • Should not be specified.
info
  • Must specify the value "status".

Response Data

In the case of successful completion:
  • Returns a “successful” HTTP status code such as 200.
  • The field status will contain information corresponding to “current status”.
  • Other values such as current-time and other request information may be included in the response data; however, formatting of these values may change in the future.
    Please use the HTTP status code to determine the success or failure of the request.
In the case of failed completion:
  • Returns a “client error” HTTP status code such as 400.
  • The key called error-messages included in the returned data will contain an error message indicating such information as the name of the parameter that caused input validation error.
  • Other values including cause of the error and other request information may be included in the returned data; however, formatting of these values may change in the future.
    Please use the HTTP status code to determine the success or failure of the request.

Example request and response

Example input values

HTTP Parameter nput value
format “json”
result “www”
info “status”

Example response for a successfully completed request

HTTP Status 200
1 request-ID: wabi_blast_1111-1111-1111-11-111-111111
2 status: finished
3 current-time: 2013-01-01 12:34:56
4 system-info:
5 stdout
HTTP Status 200
1{
2        "request-ID": "wabi_blast_1111-1111-1111-11-111-111111",
3        "status": "finished",
4        "current-time": "2013-01-01 12:34:56",
5        "system-info": "nstdout" 
6}
HTTP Status 200
1<?xml version="1.0" ?>
2<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
3<result>
4  <request-ID>wabi_blast_1111-1111-1111-11-111-111111</request-ID>
5  <status>finished</status>
6  <current-time>2013-01-01 12:34:56</current-time>
7  <system-info>stdout</system-info>
8</result>

Example response for a failed request

HTTP Status 400
 1{
 2  "status": "illegal-arguments",
 3  "message": "Illegal arguments.",
 4  "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
 5  "format": "json",
 6  "imageId": null,
 7  "info": "status",
 8  "current-time": "2013-01-01 12:34:56",
 9  "error-messages": [
10          "No such data: (requestId)" 
11  ],
12  "error-message": "BAD_REQUEST (null)" 
13}

Example Usage

Example using the REST client on Java Spring Framework:

« Close

URI GET /blast/{Request-ID}?info=request (obtain and confirm search criteria)

This will return the search criteria of a specified Request ID.

Item   Description
HTTP Method   GET
URI   “/blast/” + Request ID + “?info=request” + HTTP Parameters (example: “/blast/wabi_blast_1111-1111-1111-11-111-111111?info=request”)
HTTP Parameter format(default value = “text”) Response data format (example: “text”, “json”)

Server-Side Processing Flow

  1. Input values are validated on the server side.
    If an input validation error is found, processing is interrupted, and the server returns HTTP status 400 Bad Request.
  2. Information on the job specified by Request ID is retrieved, and the search criteria are returned.
    HTTP status code 404 is returned if the search retention period has expired or if the job information cannot be found.
  3. The server returns the current search criteria in the specified format.
    However, the server returns HTTP status code 404 Not Found if the specified format is invalid.

Input value validation check performed

requestId
  • Required value.
  • Values containing any characters other than alphanumeric, "-", and "_" will cause an input validation error.
  • Specifying a Request ID that does not exist will cause an input validation error.
    Search results are discarded after a given period and requests for these results will also result in an input validation error.
format
  • Required value.
  • Causes an input validation error if an undefined value is specified.
imageId
  • Should not be specified.
info
  • Must specify the value "request".

Response Data

In the case of successful completion:
  • Returns a “successful” HTTP status code such as 200.
  • Response data contain each parameter included when the BLAST search job was initially submitted.
  • Please use the HTTP status code to determine the success or failure of the request.
In case of failed completion:
  • Returns a “client error” HTTP status code such as 400.
  • The key called error-messages included in the returned data will contain an error message with information such as the name of the parameter that caused the input validation error.
  • Please use the HTTP status code to determine the success or failure of the request.

Example request and response

Example input values:

HTTP Parameters Input values
format “requestfile”
info “request”

Example response for a successfully completed request:

HTTP Status 200
 1{
 2        "address": "",
 3        "database": "hum",
 4        "datasets": "ddbjall",
 5        "format": "text",
 6        "parameters": " -v 100 -b 100 -e 10 -F F -W 11 ",
 7        "program": "blastn",
 8        "querySequence": ">my query sequence 1nCACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAAnGCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTGnGTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCACn",
 9        "result": "www" 
10}

Example response for a failed request:

HTTP Status 404
 1{
 2        "Message": "Unexpected error ( Results of your request id have been NOT FOUND.)",
 3        "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
 4        "format": "text",
 5        "imageId": null,
 6        "info": "result",
 7        "current-time": "2013-01-01 12:34:56",
 8        "error-messages": [
 9                "No such data: (requestId)" 
10        ],
11        "error-message": "NOT_FOUND (null)" 
12}

Example Usage

Example using the REST client on Java Spring Framework:

« Close

URI GET /blast/{Request-ID}?info=result (retrieve search results)

Returns the search results for a specified Request ID.

Item Description
HTTP Method GET
URI "/blast/" + Request ID</code> + "?info=request" + HTTP Parameters (example: "/blast/wabi_blast_1111-1111-1111-11-111-111111?info=request")
HTTP Parameter format (default value = "text") Response data format (example: "text", "json")

Server-Side Processing Flow

  1. Input values are validated on the server side.
    If an input validation error is found, processing is interrupted, and the server returns HTTP status code 400 Bad Request.
  2. Information on the job specified by Request ID is retrieved, and returns the search result.
    HTTP status code 400 or 404 is returned if the search retention period has expired or if the search processing has not yet completed.
  3. The server returns the search result using the specified format.
    However, the server returns HTTP status code 404 Not Found if the specified format is invalid.

Input validation check performed

requestId
  • Required value.
  • Values containing any characters other than alphanumeric, "-", and "_" will cause an input validation error.
  • Specifying a Request ID that does not exist will cause an input validation error.
    Search results are discarded after a given period and requests for these results will also result in an input validation error.
format
  • Required value.
  • Causes an input validation error if an undefined value is specified.
imageId
  • Should not be specified.
info
  • Must specify the value "result".

Response Data

In the case of successful completion:
  • Returns a “successful” HTTP status code such as 200.
  • Returns the content of the output file generated through the BLAST search.
  • Please use the HTTP status code to determine the success or failure of the request.
In the case of failed completion:
  • Returns a “client error” HTTP status code such as 400.
  • The key called error-messages included in the returned data will contain an error message with information such as the name of the parameter that caused the input validation error.
  • Please use the HTTP status code to determine the success or failures of the request.

Example request and response

Example of input data:

HTTP Parameters Input Value
format “bigfile”
info “result”

Example response for a successfully completed request

HTTP Status 200
 1 BLASTN 2.2.25 [Feb-01-2011]
 2 
 3 Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
 4 Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
 5 "Gapped BLAST and PSI-BLAST: a new generation of protein database search
 6 programs",  Nucleic Acids Res. 25:3389-3402.
 7 
 8 Query= AB000095|AB000095.1 Homo sapiens mRNA for hepatocyte growth
 9 factor activator inhibitor, complete cds.
10          (1740 letters)
11 
12 Database: hum
13            572,091 sequences; 5,019,832,159 total letters
14 
15 Searching..................................................done
16 
17                                                                  Score    E
18 Sequences producing significant alignments:                      (bits) Value
19 
20 AB000095|AB000095.1 Homo sapiens mRNA for hepatocyte growth fact...  3449   0.0
21 BC018702|BC018702.1 Homo sapiens serine peptidase inhibitor, Kun...  3435   0.0
22 BC004140|BC004140.1 Homo sapiens serine peptidase inhibitor, Kun...  3190   0.0
23 BT007425|BT007425.1 Homo sapiens serine protease inhibitor, Kuni...  3053   0.0
24 AY358969|AY358969.1 Homo sapiens clone DNA35880 HAI-1 (UNQ223) m...  2145   0.0
25 AY296715|AY296715.1 Homo sapiens hepatocyte growth factor activa...  1984   0.0

(後略)      

Example response data when there is an input validation error

HTTP Status 400
 1{
 2        "Message": "Error ( Results of your request id have been NOT FOUND, or still running.)",
 3        "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
 4        "format": "text",
 5        "imageId": null,
 6        "info": "result",
 7        "current-time": "2013-01-01 12:34:56",
 8        "error-messages": [
 9                "No such data: (requestId)" 
10        ],
11        "error-message": "NOT_FOUND (null)" 
12}

Usage Example

Example of the use of the REST client on Java Spring Framework:

« Close

URI GET /blast/{Request-ID}?imageId={Image-ID} (retrieve image data generated from the search result)

This method returns the image data generated from the search result specified by RequestID.

Item Description
HTTP Method GET
URI "/blast/" + RequestID + "?imageId=" + Image ID + HTTP parameters (example: "/blast/wabi_blast_1111-1111-1111-11-111-111111?imageId=1")
HTTP Parameters format (default value = "text") Response data format (example: "imagefile")

Server-side processing flow

  1. Input values are validated on the server side.
    If an invalid input value is found, then the processing is interrupted and HTTP status 400 Bad Request is returned.
  2. Information about the job corresponding to the specified RequestID is obtained, and the image generated from the BLAST search is returned.
    HTTP status code 400 or 404 is returned if the job information cannot be retrieved due to search retention period having expired or due to search job not having completed processing.
  3. The server returns the image generated from the BLAST search in the specified format.
    However, the server returns HTTP status code 404 Not Found if the specified format is invalid.

Input validation check performed

requestId
  • Required value.
  • Values containing any characters other than alphanumeric, "-", and "_" will cause an input validation error.
  • Specifying a requestId that does not exist will cause an input validation error.
    Search results are discarded after a given period and requests for these results will also result in an input validation error.
format
  • Any value other than "imagefile" will result in an input error.
imageId
  • Any value other than a numeric value will result in an input error.
info
  • Returns an input error if an undefined value is specified.

Response Data

In the case of successful completion:
  • Returns a “successful” HTTP status code such as 200.
  • Returns the image data generated from the BLAST search.
  • Please use the HTTP status code to determine the success or failure of the request.
In the case of failed completion:
  • Returns a “client error” HTTP status code such as 400.
  • The key called error-messages included in the returned data will contain an error message with information such as the name of the parameter that caused the input validation error.
  • Please use the HTTP status code to determine the success or failure of the request.

Example request and response

Example input values

HTTP Parameter Input Value
imageId "1"
format "imagefile"
info ""

Example response for a successfully completed request

HTTP Status 200
(Image Data)

Example response for a failed request

HTTP Status 404
 1 {
 2        "Message": "Error ( Blast image file of your request id have been NOT FOUND, or still running.)",
 3         "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
 4         "format": "text",
 5         "imageId": null,
 6         "info": "result",
 7         "current-time": "2013-01-01 12:34:56",
 8         "error-messages": [
 9                 "No such data: (requestId)" 
10         ],
11         "error-message": "NOT_FOUND (null)" 
12 }

Example Usage

Example using HttpURLConnection with Java:

« Close

URI GET /blast/help/{Help-Command} (View help information)

Returns the help information of WABI BLAST.

Item Description
HTTP Method GET
URI "/blast/help/" + Help-Command + HTTP Parameter (example: "/blast/help/list_program?format=json")
HTTP Parameters format (default value = "text") Response data format (example: "text", "json")
program BLAST program name (example: "blastn")

Help-Command

Help-Commands Other HTTP Parameters Help information that can be referenced
list_datasets List of defined values for the datasets parameter
list_database List of defined values for the database parameter
list_program List of defined parameters for the BLAST program parameter
list_parameters program = BLAST program List of defined optional parameters for the specified BLAST program
list_format List of defined values for the response data parameter
list_result List of defined values for the result parameter
list_info パList of defined parameters for job information to be retrieved

Response data

In the case of successful completion:
  • Returns the requested help information
In case of failed completion:
  • Returns the list of valid Help-Commands and other information.

Example request and response

Example input values:

Help-Command and other parameters nput Values
Help-Command “list_result”
format “json”

Example response for a successfully completed request:

1 {
2     "result": [
3         "www",
4         "mail" 
5     ]
6 }

Example response for a failed request:

 1 {
 2     "help_commands": [
 3         "list_datasets",
 4         "list_database",
 5         "list_program",
 6         "list_parameters",
 7         "list_format",
 8         "list_result",
 9         "list_info" 
10     ],
11     "format": [
12         "text",
13         "json",
14         "xml" 
15     ]
16 }

Example Usage

Example of the use of the REST client on Java Spring Framework:

« Close

WABI BLAST Parameters

requestId:Request ID

A string that is used to uniquely identify a BLAST search job from those registered in WABI.
WABI returns Request ID as part of the response data when the job is registered in the queue: this should be saved by the program that uses WABI.

Request ID would be needed for performing the following tasks:

  • Confirming the status of a search job
  • Confirming the search criteria
  • Viewing search results

Example Request ID:

wabi_blast_1111-1111-1111-11-111-111111

Also refer to: BLAST Help Request ID

querySequence: Query sequence data

  • Query sequence must be in FASTA format.
  • In order to assign a name to a sequence, include a line starting with “>” before each sequence.
  • If there are multiple sequences to be queried, then sequence names are mandatory in order to distinguish between the sequences (multi-FASTA format).
    Note: Increasing the number of sequences will not increase the degree of parallel processing. We recommend reducing the number of sequences searched using the web API, considering the load balancing that is applied by the job management engine.
  • Sequence name is not required if you only have one sequence to search.

Example sequence in FASTA format

>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC

Example of multiple sequences (multi-FASTA format)

>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
>my query sequence 2
GGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCGCTTCCCAGGCAACCTGCCTCACATG
CTTCGAGACCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAG
CTGGACAACATATTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAG
>my query sequence 3
ATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCAAC
TTTGCCCACGGACACAACTGCCATATCGCCTTACGGGAGATCATCGAAACTCTGAACAGC
CTCACAGAGCAGAAGACTCTGTGCACCAAGTTGACCATAACGGAC

Valid search results may not be obtained with very long sequences or if there are too many sequences for the following reasons.
In such cases, please try reducing the number of query sequences or making sequences shorter.

  • Search may end abnormally due to memory running out.
  • Search may time out due to the search taking too long.

Also refer to: BLAST Help Query name, Query sequence

datasets:Datasets

Datasets are available to assist in completing the query form on the web interface, but they are not currently used in WABI.

Valid input values that can be specified for datasets and their respective meanings are explained below.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most up-to-date information.

Dataset value Explanation
ddbjall DDBJ ALL (DDBJ periodical release + daily updates)
ddbjnew DDBJ New (DDBJ daily updates)
16S_rRNA 16S rRNA (Prokaryotes)
uniprot_all UniProt (Swiss-Prot + TrEMBL)
uniprot_sprot UniProt (Swiss-Prot)
uniprot_trembl UniProt (TrEMBL)
patent_protein Patent
dadall DAD (periodical release + daily updates)
dadnew DAD (daily updates)
refseq_na RefSeq NA
refseq_aa RefSeq AA

Also refer to: BLAST HELP Nucleotide (DATABASE, DIVISION)

database:Database

Nucleotide Sequence Database

Example nucleotide sequence database values and their corresponding explanations are listed in the table below.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

Explanation   Database value
DDBJ ALL DDBJ periodical release + daily updates (Refer to table below)
DDBJ New DDBJ daily updates (Add prefix “new_” to the values below)
16S rRNA 16S rRNA from DDBJ periodical release 16S_rRNA
RefSeq NA RefSeq (Genomics + RNA) (Refer to table below)

DDBJ ALL, DDBJ NEW Database value

Standard divisions    
hum, new_hum Human human
pri, new_pri Primates primates other than human
rod, new_rod Rodents rodents
mam, new_mam Mammals mammals other than human, primates and rodents
vrt, new_vrt Vertebrates vertebrates other than human, primates, rodents and mammals
inv, new_inv Invertebrates invertebrates
pln, new_pln Plants plants
bct, new_bct Bacteria bacteria
vrl, new_vrl Viruses viruses
phg, new_phg Phages phages
syn, new_syn Synthetic DNAs synthetic DNAs (SYN)
env, new_env ENV environmental samples(environmental samples)
High throughput divisions    
htc, new_htc HTC High Throughput cDNAs
htg, new_htg HTG High Throughput Genomic sequences
tsa, new_tsa TSA Transcriptome Shotgun Assembly
EST divisions    
est_atha, new_est_atha A.thaliana Arabidopsis thaliana (thale cress)
est_btra, new_est_btra B.taurus Bos taurus (cattle)
est_cele, new_est_cele C.elegans Caenorhabditis elegans (nematode worm)
est_crei, new_est_crei C.reinhardtii Chlamydomonas reinhardtii (Chlamydomonas:green algae)
est_cint, new_est_cint C.intestinalis Ciona intestinalis (vase tunicate)
est_drer, new_est_drer D.rerio Danio rerio (zebrafish)
est_ddis, new_est_ddis D.discoideum Dictyostelium discoideum (soil-living amoeba)
est_dmel, new_est_dmel D.melanogaster D.melanogaster (fruit fly)
est_ggal, new_est_ggal G.gallus Gallus gallus (chicken)
est_gmax, new_est_gmax G.max Glycine max (soybean)
est_hum, new_est_hum H.sapiens Homo sapiens (human)
est_hvul, new_est_hvul H.vulgare Hordeum vulgare (Barley) (incl. subspecies)
est_mtru, new_est_mtru M.truncatula Medicago truncatula (Barrel Medic) (incl. mixed library)
est_mous, new_est_mous M.musculus Mus musculus (Mouse)
est_osat, new_est_osat O.sativa Oryza sativa (incl. subspecies rank)
est_rnor, new_est_rnor R.norvegicus Rattus norvegicus (Rat) (incl. Rattus sp.)
est_slyc, new_est_slyc S.lycopersicum Solanum lycopersicum (tomato)
est_taes, new_est_taes T.aestivum Triticum aestivum (bread wheat)
est_xlae, new_est_xlae X.laevis Xenopus laevis (african clawed frog)
est_xtro, new_est_xtro X.tropicalis Xenopus tropicalis (western clawed frog)
est_zmay, new_est_zmay Z.mays Zea mays (maize)
est_rest, new_est_rest Others Others
Others    
pat, new_pat Patent patent (PAT)
una, new_una Unannotated Seq unannotated sequences (UNA)
gss, new_gss GSS genome survey sequences
sts, new_sts STS sequence tagged sites

Refseq NA Database value

RefSeq NA  
refseq-genomic-fungi, refseq-rna-fungi Fungi
refseq-genomic-invertebrate, refseq-rna-invertebrate Invertebrate
refseq-genomic-microbial, refseq-rna-microbial Microbial
refseq-genomic-mitochondrion, refseq-rna-mitochondrion Mitochondrion
refseq-genomic-plant, refseq-rna-plant Plant
refseq-genomic-plasmid, refseq-rna-plasmid Plasmid
refseq-genomic-plastid, refseq-rna-plastid Plastid
refseq-genomic-protozoa, refseq-rna-protozoa Protozoa
refseq-genomic-vertebrate_mammalian, refseq-rna-vertebrate_mammalian Vertebrate Mammalian
refseq-genomic-vertebrate_other, refseq-rna-vertebrate_other Vertebrate Other
refseq-genomic-viral, refseq-rna-viral Viral
refseq-genomic RefSeq Genomic (ALL) Periodical Release
refseq-rna RefSeq RNA (ALL) Periodical Release
refseq-na-daily RefSeq Daily Updates
refseq-na-all RefSeq ALL (Periodical Release + Daily Updates)
refseq-model-rna-B_taurus B. taurus
refseq-model-rna-D_rerio D. rerio
refseq-model-rna-H_sapiens, refseq-model-genomic-H_sapiens H. sapiens
refseq-model-rna-M_musculus M. musculus
refseq-model-rna-R_norvegicus R. norvegicus
refseq-model-rna-X_tropicalis X. tropicalis

Amino Acid Sequence Databases

Example amino acid sequence database values and their corresponding explanations are listed in the table below.

Explanation   Database value
UniProt (Swiss-Prot + TrEMBL) Swiss-Prot + TrEMBL uniprot_all
UniProt (Swiss-Prot) Swiss-Prot uniprot_sprot
UniProt (TrEMBL) TrEMBL uniprot_trembl
Patent JPO,EPO,USPTO,KIPO jpop, epop, usptop, kipop
DAD ALL periodical release + daily updates (Refer to table below)
DAD NEW daily updates (Refer to table below)
RefSeq AA RefSeq (Protein) (Refer to table below)

DAD ALL, DAD NEW Database value

Standard divisions    
dad_hum, dad_new_hum Human human
dad_pri, dad_new_pri Primates primates other than human
dad_rod, dad_new_rod Rodents rodents
dad_mam, dad_new_mam Mammals mammals other than human,primates and rodents
dad_vrt, dad_new_vrt Vertebrates vertebrates other than human,primates, rodents and mammals
dad_inv, dad_new_inv Invertebrates invertebrates
dad_pln, dad_new_pln Plants plants
dad_bct, dad_new_bct Bacteria bacteria
dad_vrl, dad_new_vrl Viruses viruses
dad_phg, dad_new_phg Phages phages
dad_syn, dad_new_syn Synthetic DNAs synthetic DNAs (SYN)
dad_env, dad_new_env General environmental samples
High throughput divisions    
dad_htc, dad_new_htc HTC High Throughput cDNAs
dad_htg, dad_new_htg HTG High Throughput Genomic sequences
dad_tsa, dad_new_tsa TSA Transcriptome Shotgun Assembly
EST divisions    
dad_est_atha, dad_new_est_atha A.thaliana Arabidopsis thaliana (thale cress)
dad_est_btra, dad_new_est_btra B.taurus Bos taurus (cattle)
dad_est_cele, dad_new_est_cele C.elegans Caenorhabditis elegans (nematode worm)
dad_est_crei, dad_new_est_crei C.reinhardtii Chlamydomonas reinhardtii (Chlamydomonas:green algae)
dad_est_cint, dad_new_est_cint C.intestinalis Ciona intestinalis (vase tunicate)
dad_est_drer, dad_new_est_drer D.rerio Danio rerio (zebrafish)
dad_est_ddis, dad_new_est_ddis D.discoideum Dictyostelium discoideum (soil-living amoeba)
dad_est_dmel, dad_new_est_dmel D.melanogaster D.melanogaster (fruit fly)
dad_est_ggal, dad_new_est_ggal G.gallus Gallus gallus (chicken)
dad_est_gmax, dad_new_est_gmax G.max Glycine max (soybean)
dad_est_hum, dad_new_est_hum H.sapiens Homo sapiens (human)
dad_est_hvul, dad_new_est_hvul H.vulgare Hordeum vulgare (Barley) (incl. subspecies)
dad_est_mtru, dad_new_est_mtru M.truncatula Medicago truncatula (Barrel Medic) (incl. mixed library)
dad_est_mous, dad_new_est_mous M.musculus Mus musculus (Mouse)
dad_est_osat, dad_new_est_osat O.sativa Oryza sativa (incl. subspecies rank)
dad_est_rnor, dad_new_est_rnor R.norvegicus Rattus norvegicus (Rat) (incl. Rattus sp.)
dad_est_slyc, dad_new_est_slyc S.lycopersicum Solanum lycopersicum (tomato)
dad_est_taes, dad_new_est_taes T.aestivum Triticum aestivum (bread wheat)
dad_est_xlae, dad_new_est_xlae X.laevis Xenopus laevis (western clawed frog)
dad_est_xtro, dad_new_est_xtro X.tropicalis Xenopus tropicalis (african clawed frog)
dad_est_zmay, dad_new_est_zmay Z.mays Zea mays (maize)
dad_est_rest, dad_new_est_rest Others Others
Others    
dad_pat, dad_new_pat Patent patent (PAT)
dad_una, dad_new_una Unannotated Seq unannotated sequences (UNA)
dad_gss, dad_new_gss GSS genome survey sequences
dad_sts, dad_new_sts STS sequence tagged sites

Refseq AA Database value

RefSeq AA    
refseq-protein-fungi Fungi  
refseq-protein-invertebrate Invertebrate  
refseq-protein-microbial Microbial  
refseq-protein-mitochondrion Mitochondrion  
refseq-protein-plant Plant  
refseq-protein-plasmid Plasmid  
refseq-protein-plastid Plastid  
refseq-protein-protozoa Protozoa  
refseq-protein-vertebrate_mammalian Vertebrate Mammalian  
refseq-protein-vertebrate_other Vertebrate Other  
refseq-protein-viral Viral  
refseq-protein RefSeq Protein (ALL) Periodical Release  
refseq-aa-daily RefSeq Protein Daily Updates  
refseq-aa-all RefSeq Protein ALL (Periodical Release + Daily Updates)  
refseq-model-protein-B_taurus B. taurus  
refseq-model-protein-D_rerio D. rerio  
refseq-model-protein-H_sapiens H. sapiens  
refseq-model-protein-M_musculus M. musculus  
refseq-model-protein-R_norvegicus R. norvegicus  
refseq-model-protein-X_tropicalis X. tropicalis  

Also refer to: BLAST HELP Nucleotide (DATABASE, DIVISION)

program:BLAST Program

You can choose from the following BLAST programs depending on the analysis being performed.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

BLAST Program query Data Base Explanation
megablast nucleotide nucleotide Aligning your nucleotide sequence with nucleotide sequence database.
When you want to perform a homology search with long length of nucleotide sequence, results are provided faster than blastn program.
blastn nucleotide nucleotide Aligning your nucleotide sequence with nucleotide sequence database.
tblastn amino acid nucleotide Aligning your amino acid sequence with nucleotide sequence database by translating database sequences taking into account all six possible open reading frames.
tblastx nucleotide nucleotide Aligning your nucleotide sequence with nucleotide sequence database by translating both sequences taking into account all six possible open reading frames.
blastp amino acid amino acid Aligning your amino acid sequence with amino acid seque nce database.
blastx nucleotide amino acid Aligning your nucleotide sequence with amino acid sequence database by translating your sequence taking into account all six possible open reading frames.

Also refer to: BLAST HELP Program

parameters:BLAST program options 

BLAST program options that can be specified are as follows:
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

Combinations of these options can be specified with corresponding values separated by spaces.

Options BLAST Program Explanation
-A N All programs Multiple Hits window size; generally defaults to 0 (for single-hit extensions), but defaults to 40 when using discontiguous templates.
-B N All programs except "megablast" Number of concatenated queries, in blastn or tblastn mode
-C X All programs except "megablast" Use composition-based statistics for blastp or tblastn:
T, t, D, or d
Default (equivalent to 1 for blast2 and blastall_old and to 2 for blastall and blastcl3)
0, F, or f
No composition-based statistics
1 Composition-based statistics as in NAR 29:2994-3005, 2001
2 Composition-based score adjustment as in Bioinformatics 21:902-911, 2005, conditioned on sequence properties
3 Composition-based score adjustment as in Bioinformatics 21:902-911, 2005, unconditionally
When enabling statistics in blastall, blastall_old, or blastcl3 (i.e., not blast2), appending u (case-insensitive) to the mode enables use of unified p-values combining alignment and compositional p-values in round 1 only.
-D N All programs except "megablast" Translate sequences in the database according to genetic code N in /usr/share/ncbi/data/gc.prt (default is 1; only applies to tblast*)
"megablast" Type of output:
0 alignment endpoints and score
1 all ungapped segments endpoints
2 traditional BLAST output (default)
3 tab-delimited one line format
4 incremental text ASN.1
5 incremental binary ASN.1
-E N "megablast" Extending a gap costs N (-1 invokes default behavior)
All programs except "megablast" Extending a gap costs N (-1 invokes default behavior: non-affine if greedy, 2 otherwise)
-Fstr All programs Filter options for DUST or SEG; defaults to T for bl2seq, blast2, blastall, blastall_old, blastcl3, and megablast, and to F for blastpgp, impala, and rpsblast.
-G N "megablast" Opening a gap costs N (-1 invokes default behavior)
All programs except "megablast" Opening a gap costs N (-1 invokes default behavior: non-affine if greedy, 5 if using dynamic programming)
-HN "megablast" Maximal number of HSPs to save per database sequence (default is 0, unlimited)
-I All programs Show GIs in deflines
-J All programs Believe the query defline
-KN All programs except "megablast" Number of best hits from a region to keep.
Off by default. If used a value of 100 is recommended.
Very high values of -v or -b are also suggested.
-Lstart, stop All programs Location on query sequence (for rpsblast, only valid in blastp mode)
-Mstr All programs except "megablast" Use matrix str (default = BLOSUM62)
-MN "megablast" Maximal total length of queries for a single search (default = 5000000)
-NN "megablast" Type of a discontiguous word template:
0 coding (default)
1 optimal
2 two simultaneous
-P N All programs except "megablast" Set to 1 for single-hit mode or 0 for multiple-hit mode (default).
Does not apply to blastn.
"megablast" Maximal number of positions for a hash value (set to 0 [default] to ignore)
-QN All programs except "megablast" Translate query according to genetic code N in /usr/share/ncbi/data/gc.prt (default is 1)
-R "megablast" Report the log information at the end of output
-SN All programs Query strands to search against database for blastn, blastx, tblastx:
1 top
2 bottom
3 both (default)
-T All programs Produce HTML output
-U All programs Use lower case filtering for the query sequence
-V All programs Force use of legacy engine
-WN All programs Use words of size N (length of best perfect match; zero invokes default behavior, except with megablast, which defaults to 28, and blastpgp, which defaults to 3. The default values for the other commands vary with "program": 11 for blastn, 28 for megablast, and 3 for everything else.)
-XN All programs X dropoff value for gapped alignment (in bits) (zero invokes default behavior, except with megablast, which defaults to 20, and rpsblast and seedtop, which default to 15. The default values for the other commands vary with "program": 30 for blastn, 20 for megablast, 0 for tblastx, and 15 for everything else.)
-YX All programs Effective length of the search space (use zero for the real size)
-ZN All programs X dropoff value for final [dynamic programming?] gapped alignment in bits (default is 100 for blastn and megablast, 0 for tblastx, 25 for others)
-bN All programs Number of database sequences to show alignments for (B) (default is 250)
-eX Expectation value (E) (default = 10.0)
-fX All programs except "megablast" Threshold for extending hits, default if zero: 0 for blastn and megablast, 11 for blastp, 12 for blastx, and 13 for tblasn and tblastx.
-f "megablast" Show full IDs in the output (default: only GIs or accessions)
-g F All programs except "megablast" Do not perform gapped alignment (N/A for tblastx)
"megablast" Make discontiguous megablast generate words for every base of the database (mandatory with the current BLAST engine)
-lstr All programs Restrict search of database to list of GI's [String]
-mN All programs alignment view options:
0 pairwise (default)
1 query-anchored showing identities
2 query-anchored, no identities
3 flat query-anchored, show identities
4 flat query-anchored, no identities
5 query-anchored, no identities and blunt ends
6 flat query-anchored, no identities and blunt ends
7 XML Blast output (not available for impala)
8 tabular (not available for impala)
9 tabular with comment lines (not available for impala)
10 ASN.1 text (not available for impala or rpsblast)
11 ASN.1 binary (not available for impala or rpsblast)
-n All programs except "megablast" megablast search
"megablast" Use non-greedy (dynamic programming) extension for affine gap scores
-pX "megablast" Identity percentage cut-off (default = 0)
-qN All programs Penalty for a nucleotide mismatch (blastn only) (default = -10 for seedtop, -3 for everything else)
-rN All programs Reward for a nucleotide match (blastn only) (default = 10 for seedtop, -10 for everything else)
-s All programs except "megablast" Compute locally optimal Smith-Waterman alignments.
For blastall, blastall_old, and blastcl3, this is only available in gapped tblastn mode.
-sN "megablast" Minimal hit score to report (0 for default behavior)
-t N All programs except "megablast" Length of a discontiguous word template (the largest intron allowed in a translated nucleotide sequence when linking multiple distinct assignments; default = 0; negative values disable linking for blastall, blastall_old, and blastcl3.)
"megablast" Length of a discontiguous word template (contiguous word if 0 [default])
-vN All programs Number of one-line descriptions to show (V) (default = 500)
-wN All programs except "megablast" Frame shift penalty (OOF algorithm for blastx)
-yX All programs except "megablast" X dropoff for ungapped extensions in bits (0.0 invokes default behavior: 20 for blastn, 10 for megablast, and 7 for all others.)
-yN "megablast" X dropoff value for ungapped extension (default is 10)
-zN All programs Effective length of the database (use zero for the real size)

Example BLAST program option:

-v 100 -b 100 -e 10 -F F -W 11

Also refer to: BLAST HELP Optional Parameters

format:Response data format

You can specify the following options to select the WABI response data format.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

Response data format Explanation Media Type
text Plain text text/plain; charset=utf-8
json JSON format application/json; charset=utf-8
xml XML text text/xml; charset=utf-8
bigfile Used when retrieving data that is output to a file, such as search results as plain text. text/plain; charset=utf-8
imagefile Image data image/png
requestfile Used when retrieving data that is output to a file, such as search results as JSON text. application/json; charset=utf-8

Note: If WABI cannot generate response data in the specified format, then it is considered an invalid input value and returns an HTTP error code.

result:Result retrieval method

The method for retrieving results can be specified from one of the following:
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

Retrieval Method Explanation
www Submit a request to a URL for retrieving a result, and receive the result as the response data to the request.
mail Result is sent to the specified email address.

address:Email address

The email address to which the results will be sent.

info:The type of job information being referenced

The following types of information can be retrieved for a submitted search job.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most up-to-date information.

Information Type Explanation
status Job status
result Search results
request Search criteria specified when the job was submitted

imageId:The ID of the image associated with a search output

This ID is used to retrieve the image data generated as part of a search.

It is required for the following case:

  • To retrieve the image data generated by a search.

Example ID for an image generated by search output:

1

Other Information

Search results are retained for 7 days.
(Refer to “Search result retention period” 「Request ID and BLAST result」)
You can obtain the processed search result at any time during this period by submitting a GET request specifying the Request ID.