WABI BLAST

Overview

WABI provides web APIs for using BLAST.

A search job is registered in a queue by submitting a BLAST search criteria. A Request ID is returned as response data.
Once a search job is registered in the queue, the state of the job transitions from “Waiting” ==> “Executing” ==> “Completed”.
Once the status of a job moves to the “Completed” state, the corresponding search results will be available for viewing. Results are retained on the server and can be viewed for up to 7 days after the search has been executed.
(Refer to “Search result retention period” 「Request ID and BLAST result」 )
Returns the status of the BLAST search for a specified Request ID.
Returns the BLAST search criteria for a specified Request ID.
Returns the BLAST search result for a specified Request ID.

Searching WABI BLAST

BLAST search job

A BLAST search job is first registered in the queue of jobs awaiting execution. The job is then executed as soon as computing resources become free.

Search Job Status

WABI search jobs transition through the following status.

Job Status	Explanation
waiting	The job has been added to the queue, but has not yet commenced execution.
running	The job is being executed.
finished	The job has completed execution.
not-found	The job with the specified Request ID does not exist.

Example response values when querying job status:

request-ID: wabi_blast_1111-1111-1111-11-111-111111
status: finished
current-time: 2013-01-01 12:34:56
system-info:
stdout

{
       "request-ID": "wabi_blast_1111-1111-1111-11-111-111111",
       "status": "finished",
       "current-time": "2013-01-01 12:34:56",
       "system-info": "nstdout" 
}
<?xml version="1.0" ?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<result>
 <request-ID>wabi_blast_1111-1111-1111-11-111-111111</request-ID>
 <status>finished</status>
 <current-time>2013-01-01 12:34:56</current-time>
 <system-info>stdout</system-info>
</result>

{
       "error-message": "Unexpected error (status == null)",
       "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
       "jobId": "123456",
       "month": "01",
       "day": "01",
       "hour": "12",
       "min": "34",
       "sec": "56",
       "millisec": "789",
       "randomId": "987654" 
}

BLAST search criteria

Example of parameters that are passed on when a BLAST job is submitted using WABI.

Example:

{
       "address": "",
      "database": "hum",
       "datasets": "ddbjall",
       "format": "json",
       "parameters": " -v 100 -b 100 -e 10 -F F -W 11",
       "program": "blastn",
      "querySequence": ">my query sequence 1nCACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAAnGCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTGnGTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCACn",
      "result": "www" 
}

BLAST search result

The following is an example of the BLAST search output. This is the same as the file generated using the blastall command, when executed using the “-o” command line option.

Example:

BLASTN 2.2.25 [Feb-01-2011]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= AB000095|AB000095.1 Homo sapiens mRNA for hepatocyte growth
factor activator inhibitor, complete cds.
        (1740 letters)

Database: hum
          572,091 sequences; 5,019,832,159 total letters

Searching..................................................done

                                                                Score    E
Sequences producing significant alignments:                      (bits) Value

AB000095|AB000095.1 Homo sapiens mRNA for hepatocyte growth fact...  3449   0.0
BC018702|BC018702.1 Homo sapiens serine peptidase inhibitor, Kun...  3435   0.0
BC004140|BC004140.1 Homo sapiens serine peptidase inhibitor, Kun...  3190   0.0
BT007425|BT007425.1 Homo sapiens serine protease inhibitor, Kuni...  3053   0.0
AY358969|AY358969.1 Homo sapiens clone DNA35880 HAI-1 (UNQ223) m...  2145   0.0
AY296715|AY296715.1 Homo sapiens hepatocyte growth factor activa...  1984   0.0
(後略)
        

BLAST search result image

BLAST search jobs submitted using WABI generate a graphical display of the search output.

Example:

WABI BLAST usage examples

Code example using Ruby

Example of code

example.rb

blast_condition.fasta

>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC

blast_condition.txt

Code

datasets        ddbjall
database        hum
program blastn
parameters      -v 100 -b 100 -e 10 -F F -W 11
format  json
result  www

Execution example

Execution procedure

$ ruby example.rb

Actual example

Example of the execution result

wabi_blast_2013-0606-1336-31-681-634313.txt

« Close

WABI BLAST Details

URI POST /blast (submit a search job)

This method appends a BLAST search to the job queue and returns the Request ID.
The BLAST search criteria, method for notifying the result, and other options are specified using HTTP parameters.

Item		Description
HTTP Method		POST
URI		/blast
HTTP Parameters	`querySequence`	Search sequence data in multi-FASTA format `example: >my query sequence 1 CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC` Note: Increasing the number of sequences will not increase the degree of parallel processing. We recommend reducing the number of sequences searched for the web API, as this will better balance the load on the job management engine.
	`datasets`	Dataset (example: `"ddbjall"`)
	`database`	database (example: `"hum"`, `"hum pri"`)
	`program`	BLAST program (example: `"blastn"`)
	`parameters`	Other options (example: `"-v 100 -b 100 -e 10 -F F -W 11"`)
	`format`	response data format (example: `"text"`, `"json"`)
	`result`	result retrieval method (example: `"www"`, `"mail"`)
	`address`	Email address
Request action		Add a new BLAST search job to the queue for processing.
HTTP Response	If successful	Request ID
HTTP Response	If failed	HTTP status 4xx

Server-side processing flow

Check validity of input values.
If an invalid input value is found, then the processing is interrupted and HTTP status 400 Bad Request is returned.
Add the BLAST search into the job queue.
Information about the job added to the queue is returned using the specified format.
If the specified format is not available, then HTTP status 404 Not Found is returned.

Input validation check performed

datasets (optional)	Causes an input validation error if an undefined value is specified. Note: Currently not used. Consistency check between the `database` is not performed.
database	Required value. Database names must be separated by spaces; otherwise, the check will cause an input validation error. Database names must comprise only alphabets and underscore "_". example: `"hum"`, `"hum pri"` and so on.
program	Required value. Causes an input validation error if an undefined value is specified.
format	Required value. Causes an input validation error if an undefined value is specified.
parameters (optional)	Causes an input validation error unless options and corresponding values are listed using space as separators. Causes an input validation error if invalid options are specified. A valid option depends on the specified `program`, as follows: In case `program` value is `"megablast"` : Options must be one or more of `ADEFGHIJLMNPRSTUVWXYZbefglmnpqrstvyz`; other options will cause an input validation error. example: `"-A"` is a valid option, but `"-B"` will cause an input validation error. For all other `program` values: Options must be one or more of `ABCDEFGIJKLMPQSTUVWXYZbefglmnqrstvwyz`; other options will cause an input validation error. example: `"-B"` is a valid option, but `"-H"` will cause an input validation error. Option values can be a numeric value, alphanumeric characters, or comma-separated alphanumeric characters. example: `"-1"`, `"foo, bar"`, etc.
result	Required value. Causes an input validation error if an undefined value is specified.
address	Requires value if the value of `result` is `"mail"`. Only a valid email address is permitted. Other values will cause an input validation error.

Response data

In the case of successful completion:

A “successful” HTTP status code such as 200 will be returned.
The field requestId will contain Request ID.
Other values such as current-time and other request information may be included in the response data; however, formatting of these values may change in the future.
Please use the HTTP status code to determine the success or failure of the request.

In the case of failed completion:

A “client error” HTTP status code such as 400 will be returned.
The key called error-messages included in the returned data will contain an error message indicating information such as the name of the parameter that caused input validation error.
Other values including the cause of the error and other request information may be included in the returned data; however, formatting of these values may change in the future.
Please use the HTTP status code to determine the success or failure of the request.

Example request and response

Examples of input data

HTTP Parameter	Input Value
`address`	`""`
`database`	`"hum"`
`datasets`	`"ddbjall"`
`format`	`"json"`
`parameters`	`" -v 100 -b 100 -e 10 -F F -W 11"`
`program`	`"blastn"`
`querySequence`	`>my query sequence 1 CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC`
`result`	`"www"`

Example response for a successfully completed request

HTTP Status 200
{
      "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
      "program": "blastn",
      "datasets": "ddbjall",
      "database": "hum",
      "parameters": " -v 100 -b 100 -e 10 -F F -W 11 ",
      "current-time": "2013-01-01 12:34:56",
      "start-time": "",
      "current-state": "" 
}

HTTP Status 200
<?xml version="1.0" ?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<result>
 <requestId>wabi_blast_1111-1111-1111-11-111-111111</requestId>
 <program>blastn</program>
 <datasets>ddbjall</datasets>
 <database>hum</database>
 <parameters> -v 100 -b 100 -e 10 -F F -W 11 </parameters>
 <current-time>2013-01-01 12:34:56</current-time>
 <start-time></start-time>
 <current-state></current-state>
</result>

Example response data when there is an input validation error

HTTP Status 400
  {
  "status": "illegal-arguments",
  "message": "Illegal arguments.",
  "format": null,
  "program": "blastn",
  "datasets": "ddbjall",
  "database": "hum",
  "parameters": null,
  "querySequence": ">my query sequence 1nCACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAAnGCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTGnGTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCACn",
  "result": "",
  "address": null,
  "current-time": "2013-01-01 12:34:56",
  "error-messages": [
      "Required: (result)" 
  ],
  "error-message": "BAD_REQUEST (null)" 
  }

URI GET /blast/{Request-ID}?info=status (query the status of a search job)

Returns the status of the job specified by Request ID.

Item		Description
HTTP Method		`GET`
URI		`"/blast/"` + Request ID + HTTP Parameter (example: `"/blast/wabi_blast_1111-1111-1111-11-111-111111?info=status"`)
HTTP Parameters	`info` (default value = `"status"`)	Job information type (example: `"status"`, `"result"`)
HTTP Parameters	`format` (default value = `"text"`)	Response data format (example: `"text"`, `"json"`)

Server-Side Processing Flow

Input values are validated on the server side.
If an input validation error is found, processing is interrupted, and the server returns HTTP status 400 Bad Request.
The server obtains job information corresponding to the specified Request ID and returns the current status.
HTTP status code 404 is returned if the search retention period has expired or if the job information cannot be found.
The server returns the obtained current job’s status using the specified format.
However, the server returns HTTP status 404 Not Found if the specified format is invalid.

Input value validation check performed

requestId	Required value. Values containing any characters other than alphanumeric, `"-"`, and `"_"` will cause an input validation error. Any Request ID that does not exist will cause an input validation error. Search results are discarded after a given period; it will be considered to be an input validation error in this case as well.
format	Required value. Causes an input validation error if an undefined value is passed.
imageId	Should not be specified.
info	Must specify the value `"status"`.

Response Data

In the case of successful completion:

Returns a “successful” HTTP status code such as 200.
The field status will contain information corresponding to “current status”.
Other values such as current-time and other request information may be included in the response data; however, formatting of these values may change in the future.
Please use the HTTP status code to determine the success or failure of the request.

In the case of failed completion:

Returns a “client error” HTTP status code such as 400.
The key called error-messages included in the returned data will contain an error message indicating such information as the name of the parameter that caused input validation error.
Other values including cause of the error and other request information may be included in the returned data; however, formatting of these values may change in the future.
Please use the HTTP status code to determine the success or failure of the request.

Example request and response

Example input values

HTTP Parameter	nput value
format	“json”
result	“www”
info	“status”

Example response for a successfully completed request

HTTP Status 200
request-ID: wabi_blast_1111-1111-1111-11-111-111111
status: finished
current-time: 2013-01-01 12:34:56
system-info:
stdout

HTTP Status 200
1{
2        "request-ID": "wabi_blast_1111-1111-1111-11-111-111111",
3        "status": "finished",
4        "current-time": "2013-01-01 12:34:56",
5        "system-info": "nstdout" 
6}

HTTP Status 200
1<?xml version="1.0" ?>
2<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
3<result>
4  <request-ID>wabi_blast_1111-1111-1111-11-111-111111</request-ID>
5  <status>finished</status>
6  <current-time>2013-01-01 12:34:56</current-time>
7  <system-info>stdout</system-info>
8</result>

Example response for a failed request

HTTP Status 400
 1{
"status": "illegal-arguments",
"message": "Illegal arguments.",
"requestId": "wabi_blast_1111-1111-1111-11-111-111111",
"format": "json",
"imageId": null,
"info": "status",
"current-time": "2013-01-01 12:34:56",
"error-messages": [
        "No such data: (requestId)" 
],
"error-message": "BAD_REQUEST (null)" 
13}

URI GET /blast/{Request-ID}?info=request (obtain and confirm search criteria)

This will return the search criteria of a specified Request ID.

Item		Description
HTTP Method		`GET`
URI		`“/blast/”` + Request ID + `“?info=request”` + HTTP Parameters (example: `“/blast/wabi_blast_1111-1111-1111-11-111-111111?info=request”`)
HTTP Parameter	`format`(default value = `“text”`)	Response data format (example: `“text”`, `“json”`)

Server-Side Processing Flow

Input values are validated on the server side.
If an input validation error is found, processing is interrupted, and the server returns HTTP status 400 Bad Request.
Information on the job specified by Request ID is retrieved, and the search criteria are returned.
HTTP status code 404 is returned if the search retention period has expired or if the job information cannot be found.
The server returns the current search criteria in the specified format.
However, the server returns HTTP status code 404 Not Found if the specified format is invalid.

Input value validation check performed

requestId	Required value. Values containing any characters other than alphanumeric, `"-"`, and `"_"` will cause an input validation error. Specifying a Request ID that does not exist will cause an input validation error. Search results are discarded after a given period and requests for these results will also result in an input validation error.
format	Required value. Causes an input validation error if an undefined value is specified.
imageId	Should not be specified.
info	Must specify the value `"request"`.

Response Data

In the case of successful completion:

Returns a “successful” HTTP status code such as 200.
Response data contain each parameter included when the BLAST search job was initially submitted.
Please use the HTTP status code to determine the success or failure of the request.

In case of failed completion:

Returns a “client error” HTTP status code such as 400.
The key called error-messages included in the returned data will contain an error message with information such as the name of the parameter that caused the input validation error.
Please use the HTTP status code to determine the success or failure of the request.

Example request and response

Example input values:

HTTP Parameters	Input values
format	“requestfile”
info	“request”

Example response for a successfully completed request:

HTTP Status 200
 1{
      "address": "",
      "database": "hum",
      "datasets": "ddbjall",
      "format": "text",
      "parameters": " -v 100 -b 100 -e 10 -F F -W 11 ",
      "program": "blastn",
      "querySequence": ">my query sequence 1nCACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAAnGCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTGnGTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCACn",
      "result": "www" 
10}

Example response for a failed request:

HTTP Status 404
 1{
      "Message": "Unexpected error ( Results of your request id have been NOT FOUND.)",
      "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
      "format": "text",
      "imageId": null,
      "info": "result",
      "current-time": "2013-01-01 12:34:56",
      "error-messages": [
              "No such data: (requestId)" 
      ],
      "error-message": "NOT_FOUND (null)" 
12}

URI GET /blast/{Request-ID}?info=result (retrieve search results)

Returns the search results for a specified Request ID.

Item		Description
HTTP Method		`GET`
URI		`"/blast/"` + Request ID</code> + `"?info=request"` + HTTP Parameters (example: `"/blast/wabi_blast_1111-1111-1111-11-111-111111?info=request"`)
HTTP Parameter	`format` (default value = `"text"`)	Response data format (example: `"text"`, `"json"`)

Server-Side Processing Flow

Input values are validated on the server side.
If an input validation error is found, processing is interrupted, and the server returns HTTP status code 400 Bad Request.
Information on the job specified by Request ID is retrieved, and returns the search result.
HTTP status code 400 or 404 is returned if the search retention period has expired or if the search processing has not yet completed.
The server returns the search result using the specified format.
However, the server returns HTTP status code 404 Not Found if the specified format is invalid.

Input validation check performed

requestId	Required value. Values containing any characters other than alphanumeric, `"-"`, and `"_"` will cause an input validation error. Specifying a Request ID that does not exist will cause an input validation error. Search results are discarded after a given period and requests for these results will also result in an input validation error.
format	Required value. Causes an input validation error if an undefined value is specified.
imageId	Should not be specified.
info	Must specify the value `"result"`.

Response Data

In the case of successful completion:

Returns a “successful” HTTP status code such as 200.
Returns the content of the output file generated through the BLAST search.
Please use the HTTP status code to determine the success or failure of the request.

In the case of failed completion:

Returns a “client error” HTTP status code such as 400.
The key called error-messages included in the returned data will contain an error message with information such as the name of the parameter that caused the input validation error.
Please use the HTTP status code to determine the success or failures of the request.

Example request and response

Example of input data:

HTTP Parameters	Input Value
format	“bigfile”
info	“result”

Example response for a successfully completed request

HTTP Status 200
BLASTN 2.2.25 [Feb-01-2011]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= AB000095|AB000095.1 Homo sapiens mRNA for hepatocyte growth
factor activator inhibitor, complete cds.
        (1740 letters)

Database: hum
          572,091 sequences; 5,019,832,159 total letters

Searching..................................................done

                                                                Score    E
Sequences producing significant alignments:                      (bits) Value

AB000095|AB000095.1 Homo sapiens mRNA for hepatocyte growth fact...  3449   0.0
BC018702|BC018702.1 Homo sapiens serine peptidase inhibitor, Kun...  3435   0.0
BC004140|BC004140.1 Homo sapiens serine peptidase inhibitor, Kun...  3190   0.0
BT007425|BT007425.1 Homo sapiens serine protease inhibitor, Kuni...  3053   0.0
AY358969|AY358969.1 Homo sapiens clone DNA35880 HAI-1 (UNQ223) m...  2145   0.0
AY296715|AY296715.1 Homo sapiens hepatocyte growth factor activa...  1984   0.0

(後略)      

Example response data when there is an input validation error

HTTP Status 400
 1{
      "Message": "Error ( Results of your request id have been NOT FOUND, or still running.)",
      "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
      "format": "text",
      "imageId": null,
      "info": "result",
      "current-time": "2013-01-01 12:34:56",
      "error-messages": [
              "No such data: (requestId)" 
      ],
      "error-message": "NOT_FOUND (null)" 
12}

URI GET /blast/{Request-ID}?imageId={Image-ID} (retrieve image data generated from the search result)

This method returns the image data generated from the search result specified by RequestID.

Item		Description
HTTP Method		`GET`
URI		`"/blast/"` + RequestID + `"?imageId="` + Image ID + HTTP parameters (example: `"/blast/wabi_blast_1111-1111-1111-11-111-111111?imageId=1"`)
HTTP Parameters	`format` (default value = `"text"`)	Response data format (example: `"imagefile"`)

Server-side processing flow

Input values are validated on the server side.
If an invalid input value is found, then the processing is interrupted and HTTP status 400 Bad Request is returned.
Information about the job corresponding to the specified RequestID is obtained, and the image generated from the BLAST search is returned.
HTTP status code 400 or 404 is returned if the job information cannot be retrieved due to search retention period having expired or due to search job not having completed processing.
The server returns the image generated from the BLAST search in the specified format.
However, the server returns HTTP status code 404 Not Found if the specified format is invalid.

Input validation check performed

requestId	Required value. Values containing any characters other than alphanumeric, `"-"`, and `"_"` will cause an input validation error. Specifying a requestId that does not exist will cause an input validation error. Search results are discarded after a given period and requests for these results will also result in an input validation error.
format	Any value other than `"imagefile"` will result in an input error.
imageId	Any value other than a numeric value will result in an input error.
info	Returns an input error if an undefined value is specified.

Response Data

In the case of successful completion:

Returns a “successful” HTTP status code such as 200.
Returns the image data generated from the BLAST search.
Please use the HTTP status code to determine the success or failure of the request.

In the case of failed completion:

Returns a “client error” HTTP status code such as 400.
The key called error-messages included in the returned data will contain an error message with information such as the name of the parameter that caused the input validation error.
Please use the HTTP status code to determine the success or failure of the request.

Example request and response

Example input values

HTTP Parameter	Input Value
`imageId`	`"1"`
`format`	`"imagefile"`
`info`	`""`

Example response for a successfully completed request

HTTP Status 200
(Image Data)

Example response for a failed request

HTTP Status 404
{
      "Message": "Error ( Blast image file of your request id have been NOT FOUND, or still running.)",
       "requestId": "wabi_blast_1111-1111-1111-11-111-111111",
       "format": "text",
       "imageId": null,
       "info": "result",
       "current-time": "2013-01-01 12:34:56",
       "error-messages": [
               "No such data: (requestId)" 
       ],
       "error-message": "NOT_FOUND (null)" 
}

URI GET /blast/help/{Help-Command} (View help information)

Returns the help information of WABI BLAST.

Item		Description
HTTP Method		`GET`
URI		`"/blast/help/"` + Help-Command + HTTP Parameter (example: `"/blast/help/list_program?format=json"`)
HTTP Parameters	`format` (default value = `"text"`)	Response data format (example: `"text"`, `"json"`)
HTTP Parameters	`program`	BLAST program name (example: `"blastn"`)

Help-Command

Help-Commands	Other HTTP Parameters	Help information that can be referenced
`list_datasets`		List of defined values for the datasets parameter
`list_database`		List of defined values for the database parameter
`list_program`		List of defined parameters for the BLAST program parameter
`list_parameters`	`program` = BLAST program	List of defined optional parameters for the specified BLAST program
`list_format`		List of defined values for the response data parameter
`list_result`		List of defined values for the result parameter
`list_info`		パList of defined parameters for job information to be retrieved

Response data

In the case of successful completion:

Returns the requested help information

In case of failed completion:

Returns the list of valid Help-Commands and other information.

Example request and response

Example input values:

Help-Command and other parameters	nput Values
Help-Command	“list_result”
format	“json”

Example response for a successfully completed request:

{
   "result": [
       "www",
       "mail" 
   ]
}

Example response for a failed request:

{
   "help_commands": [
       "list_datasets",
       "list_database",
       "list_program",
       "list_parameters",
       "list_format",
       "list_result",
       "list_info" 
   ],
   "format": [
       "text",
       "json",
       "xml" 
   ]
}

WABI BLAST Parameters

requestId：Request ID

A string that is used to uniquely identify a BLAST search job　from those registered in WABI.
WABI returns Request ID as part of the response data when the job is registered in the queue: this should be saved by the program that uses WABI.

Request ID would be needed for performing the following tasks:

Confirming the status of a search job
Confirming the search criteria
Viewing search results

Example Request ID:

wabi_blast_1111-1111-1111-11-111-111111

Also refer to: BLAST Help Request ID

querySequence： Query sequence data

Query sequence must be in FASTA format.
In order to assign a name to a sequence, include a line starting with “>” before each sequence.
If there are multiple sequences to be queried, then sequence names are mandatory in order to distinguish between the sequences (multi-FASTA format).
Note: Increasing the number of sequences will not increase the degree of parallel processing. We recommend reducing the number of sequences searched using the web API, considering the load balancing that is applied by the job management engine.
Sequence name is not required if you only have one sequence to search.

Example sequence in FASTA format

>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC

Example of multiple sequences (multi-FASTA format)

>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
>my query sequence 2
GGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCGCTTCCCAGGCAACCTGCCTCACATG
CTTCGAGACCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAG
CTGGACAACATATTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAG
>my query sequence 3
ATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCAAC
TTTGCCCACGGACACAACTGCCATATCGCCTTACGGGAGATCATCGAAACTCTGAACAGC
CTCACAGAGCAGAAGACTCTGTGCACCAAGTTGACCATAACGGAC

Valid search results may not be obtained with very long sequences or if there are too many sequences for the following reasons.
In such cases, please try reducing the number of query sequences or making sequences shorter.

Search may end abnormally due to memory running out.
Search may time out due to the search taking too long.

Also refer to: BLAST Help Query name, Query sequence

datasets：Datasets

Datasets are available to assist in completing the query form on the web interface, but they are not currently used in WABI.

Valid input values that can be specified for datasets and their respective meanings are explained below.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most up-to-date information.

Dataset value	Explanation
`ddbjall`	DDBJ ALL (DDBJ periodical release + daily updates)
`ddbjnew`	DDBJ New (DDBJ daily updates)
`16S_rRNA`	16S rRNA (Prokaryotes)
`uniprot_all`	UniProt (Swiss-Prot + TrEMBL)
`uniprot_sprot`	UniProt (Swiss-Prot)
`uniprot_trembl`	UniProt (TrEMBL)
`patent_protein`	Patent
`dadall`	DAD (periodical release + daily updates)
`dadnew`	DAD (daily updates)
`refseq_na`	RefSeq NA
`refseq_aa`	RefSeq AA

Also refer to: BLAST HELP Nucleotide (DATABASE, DIVISION)

database：Database

Nucleotide Sequence Database

Example nucleotide sequence database values and their corresponding explanations are listed in the table below.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

Explanation		Database value
DDBJ ALL	DDBJ periodical release + daily updates	(Refer to table below)
DDBJ New	DDBJ daily updates	(Add prefix “new_” to the values below)
16S rRNA	16S rRNA from DDBJ periodical release	16S_rRNA
RefSeq NA	RefSeq (Genomics + RNA)	(Refer to table below)

DDBJ ALL, DDBJ NEW Database value

Standard divisions
`hum`, `new_hum`	Human	human
`pri`, `new_pri`	Primates	primates other than human
`rod`, `new_rod`	Rodents	rodents
`mam`, `new_mam`	Mammals	mammals other than human, primates and rodents
`vrt`, `new_vrt`	Vertebrates	vertebrates other than human, primates, rodents and mammals
`inv`, `new_inv`	Invertebrates	invertebrates
`pln`, `new_pln`	Plants	plants
`bct`, `new_bct`	Bacteria	bacteria
`vrl`, `new_vrl`	Viruses	viruses
`phg`, `new_phg`	Phages	phages
`syn`, `new_syn`	Synthetic DNAs	synthetic DNAs (SYN)
`env`, `new_env`	ENV	environmental samples(environmental samples)

High throughput divisions
`htc`, `new_htc`	HTC	High Throughput cDNAs
`htg`, `new_htg`	HTG	High Throughput Genomic sequences
`tsa`, `new_tsa`	TSA	Transcriptome Shotgun Assembly

EST divisions
`est_atha`, `new_est_atha`	A.thaliana	Arabidopsis thaliana (thale cress)
`est_btra`, `new_est_btra`	B.taurus	Bos taurus (cattle)
`est_cele`, `new_est_cele`	C.elegans	Caenorhabditis elegans (nematode worm)
`est_crei`, `new_est_crei`	C.reinhardtii	Chlamydomonas reinhardtii (Chlamydomonas:green algae)
`est_cint`, `new_est_cint`	C.intestinalis	Ciona intestinalis (vase tunicate)
`est_drer`, `new_est_drer`	D.rerio	Danio rerio (zebrafish)
`est_ddis`, `new_est_ddis`	D.discoideum	Dictyostelium discoideum (soil-living amoeba)
`est_dmel`, `new_est_dmel`	D.melanogaster	D.melanogaster (fruit fly)
`est_ggal`, `new_est_ggal`	G.gallus	Gallus gallus (chicken)
`est_gmax`, `new_est_gmax`	G.max	Glycine max (soybean)
`est_hum`, `new_est_hum`	H.sapiens	Homo sapiens (human)
`est_hvul`, `new_est_hvul`	H.vulgare	Hordeum vulgare (Barley) (incl. subspecies)
`est_mtru`, `new_est_mtru`	M.truncatula	Medicago truncatula (Barrel Medic) (incl. mixed library)
`est_mous`, `new_est_mous`	M.musculus	Mus musculus (Mouse)
`est_osat`, `new_est_osat`	O.sativa	Oryza sativa (incl. subspecies rank)
`est_rnor`, `new_est_rnor`	R.norvegicus	Rattus norvegicus (Rat) (incl. Rattus sp.)
`est_slyc`, `new_est_slyc`	S.lycopersicum	Solanum lycopersicum (tomato)
`est_taes`, `new_est_taes`	T.aestivum	Triticum aestivum (bread wheat)
`est_xlae`, `new_est_xlae`	X.laevis	Xenopus laevis (african clawed frog)
`est_xtro`, `new_est_xtro`	X.tropicalis	Xenopus tropicalis (western clawed frog)
`est_zmay`, `new_est_zmay`	Z.mays	Zea mays (maize)
`est_rest`, `new_est_rest`	Others	Others

Others
`pat`, `new_pat`	Patent	patent (PAT)
`una`, `new_una`	Unannotated Seq	unannotated sequences (UNA)
`gss`, `new_gss`	GSS	genome survey sequences
`sts`, `new_sts`	STS	sequence tagged sites

Refseq NA Database value

RefSeq NA
`refseq-genomic-fungi`, `refseq-rna-fungi`	Fungi
`refseq-genomic-invertebrate`, `refseq-rna-invertebrate`	Invertebrate
`refseq-genomic-microbial`, `refseq-rna-microbial`	Microbial
`refseq-genomic-mitochondrion`, `refseq-rna-mitochondrion`	Mitochondrion
`refseq-genomic-plant`, `refseq-rna-plant`	Plant
`refseq-genomic-plasmid`, `refseq-rna-plasmid`	Plasmid
`refseq-genomic-plastid`, `refseq-rna-plastid`	Plastid
`refseq-genomic-protozoa`, `refseq-rna-protozoa`	Protozoa
`refseq-genomic-vertebrate_mammalian`, `refseq-rna-vertebrate_mammalian`	Vertebrate Mammalian
`refseq-genomic-vertebrate_other`, `refseq-rna-vertebrate_other`	Vertebrate Other
`refseq-genomic-viral`, `refseq-rna-viral`	Viral
`refseq-genomic`	RefSeq Genomic (ALL) Periodical Release
`refseq-rna`	RefSeq RNA (ALL) Periodical Release
`refseq-na-daily`	RefSeq Daily Updates
`refseq-na-all`	RefSeq ALL (Periodical Release + Daily Updates)
`refseq-model-rna-B_taurus`	B. taurus
`refseq-model-rna-D_rerio`	D. rerio
`refseq-model-rna-H_sapiens`, refseq-model-genomic-H_sapiens	H. sapiens
`refseq-model-rna-M_musculus`	M. musculus
`refseq-model-rna-R_norvegicus`	R. norvegicus
`refseq-model-rna-X_tropicalis`	X. tropicalis

Amino Acid Sequence Databases

Example amino acid sequence database values and their corresponding explanations are listed in the table below.

Explanation		Database value
UniProt (Swiss-Prot + TrEMBL)	Swiss-Prot + TrEMBL	`uniprot_all`
UniProt (Swiss-Prot)	Swiss-Prot	`uniprot_sprot`
UniProt (TrEMBL)	TrEMBL	`uniprot_trembl`
Patent	JPO，EPO，USPTO，KIPO	`jpop`, `epop`, `usptop`, `kipop`
DAD ALL	periodical release + daily updates	(Refer to table below)
DAD NEW	daily updates	(Refer to table below)
RefSeq AA	RefSeq (Protein)	(Refer to table below)

DAD ALL, DAD NEW Database value

Standard divisions
`dad_hum`, `dad_new_hum`	Human	human
`dad_pri`, `dad_new_pri`	Primates	primates other than human
`dad_rod`, `dad_new_rod`	Rodents	rodents
`dad_mam`, `dad_new_mam`	Mammals	mammals other than human，primates and rodents
`dad_vrt`, `dad_new_vrt`	Vertebrates	vertebrates other than human，primates, rodents and mammals
`dad_inv`, `dad_new_inv`	Invertebrates	invertebrates
`dad_pln`, `dad_new_pln`	Plants	plants
`dad_bct`, `dad_new_bct`	Bacteria	bacteria
`dad_vrl`, `dad_new_vrl`	Viruses	viruses
`dad_phg`, `dad_new_phg`	Phages	phages
`dad_syn`, `dad_new_syn`	Synthetic DNAs	synthetic DNAs (SYN)
`dad_env`, `dad_new_env`	General	environmental samples

High throughput divisions
`dad_htc`, `dad_new_htc`	HTC	High Throughput cDNAs
`dad_htg`, `dad_new_htg`	HTG	High Throughput Genomic sequences
`dad_tsa`, `dad_new_tsa`	TSA	Transcriptome Shotgun Assembly

EST divisions
`dad_est_atha`, `dad_new_est_atha`	A.thaliana	Arabidopsis thaliana (thale cress)
`dad_est_btra`, `dad_new_est_btra`	B.taurus	Bos taurus (cattle)
`dad_est_cele`, `dad_new_est_cele`	C.elegans	Caenorhabditis elegans (nematode worm)
`dad_est_crei`, `dad_new_est_crei`	C.reinhardtii	Chlamydomonas reinhardtii (Chlamydomonas:green algae)
`dad_est_cint`, `dad_new_est_cint`	C.intestinalis	Ciona intestinalis (vase tunicate)
`dad_est_drer`, `dad_new_est_drer`	D.rerio	Danio rerio (zebrafish)
`dad_est_ddis`, `dad_new_est_ddis`	D.discoideum	Dictyostelium discoideum (soil-living amoeba)
`dad_est_dmel`, `dad_new_est_dmel`	D.melanogaster	D.melanogaster (fruit fly)
`dad_est_ggal`, `dad_new_est_ggal`	G.gallus	Gallus gallus (chicken)
`dad_est_gmax`, `dad_new_est_gmax`	G.max	Glycine max (soybean)
`dad_est_hum`, `dad_new_est_hum`	H.sapiens	Homo sapiens (human)
`dad_est_hvul`, `dad_new_est_hvul`	H.vulgare	Hordeum vulgare (Barley) (incl. subspecies)
`dad_est_mtru`, `dad_new_est_mtru`	M.truncatula	Medicago truncatula (Barrel Medic) (incl. mixed library)
`dad_est_mous`, `dad_new_est_mous`	M.musculus	Mus musculus (Mouse)
`dad_est_osat`, `dad_new_est_osat`	O.sativa	Oryza sativa (incl. subspecies rank)
`dad_est_rnor`, `dad_new_est_rnor`	R.norvegicus	Rattus norvegicus (Rat) (incl. Rattus sp.)
`dad_est_slyc`, `dad_new_est_slyc`	S.lycopersicum	Solanum lycopersicum (tomato)
`dad_est_taes`, `dad_new_est_taes`	T.aestivum	Triticum aestivum (bread wheat)
`dad_est_xlae`, `dad_new_est_xlae`	X.laevis	Xenopus laevis (western clawed frog)
`dad_est_xtro`, `dad_new_est_xtro`	X.tropicalis	Xenopus tropicalis (african clawed frog)
`dad_est_zmay`, `dad_new_est_zmay`	Z.mays	Zea mays (maize)
`dad_est_rest`, `dad_new_est_rest`	Others	Others

Others
`dad_pat`, `dad_new_pat`	Patent	patent (PAT)
`dad_una`, `dad_new_una`	Unannotated Seq	unannotated sequences (UNA)
`dad_gss`, `dad_new_gss`	GSS	genome survey sequences
`dad_sts`, `dad_new_sts`	STS	sequence tagged sites

Refseq AA Database value

RefSeq AA
`refseq-protein-fungi`	Fungi
`refseq-protein-invertebrate`	Invertebrate
`refseq-protein-microbial`	Microbial
`refseq-protein-mitochondrion`	Mitochondrion
`refseq-protein-plant`	Plant
`refseq-protein-plasmid`	Plasmid
`refseq-protein-plastid`	Plastid
`refseq-protein-protozoa`	Protozoa
`refseq-protein-vertebrate_mammalian`	Vertebrate Mammalian
`refseq-protein-vertebrate_other`	Vertebrate Other
`refseq-protein-viral`	Viral
`refseq-protein`	RefSeq Protein (ALL) Periodical Release
`refseq-aa-daily`	RefSeq Protein Daily Updates
`refseq-aa-all`	RefSeq Protein ALL (Periodical Release + Daily Updates)
`refseq-model-protein-B_taurus`	B. taurus
`refseq-model-protein-D_rerio`	D. rerio
`refseq-model-protein-H_sapiens`	H. sapiens
`refseq-model-protein-M_musculus`	M. musculus
`refseq-model-protein-R_norvegicus`	R. norvegicus
`refseq-model-protein-X_tropicalis`	X. tropicalis

Also refer to: BLAST HELP Nucleotide (DATABASE, DIVISION)

program：BLAST Program

You can choose from the following BLAST programs depending on the analysis being performed.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

BLAST Program	query	Data Base	Explanation
megablast	nucleotide	nucleotide	Aligning your nucleotide sequence with nucleotide sequence database. When you want to perform a homology search with long length of nucleotide sequence, results are provided faster than blastn program.
blastn	nucleotide	nucleotide	Aligning your nucleotide sequence with nucleotide sequence database.
tblastn	amino acid	nucleotide	Aligning your amino acid sequence with nucleotide sequence database by translating database sequences taking into account all six possible open reading frames.
tblastx	nucleotide	nucleotide	Aligning your nucleotide sequence with nucleotide sequence database by translating both sequences taking into account all six possible open reading frames.
blastp	amino acid	amino acid	Aligning your amino acid sequence with amino acid seque nce database.
blastx	nucleotide	amino acid	Aligning your nucleotide sequence with amino acid sequence database by translating your sequence taking into account all six possible open reading frames.

Also refer to: BLAST HELP Program

parameters：BLAST program options　

BLAST program options that can be specified are as follows:
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

Combinations of these options can be specified with corresponding values separated by spaces.

Options	BLAST Program	Explanation
`-A`　N	All programs	Multiple Hits window size; generally defaults to 0 (for single-hit extensions), but defaults to 40 when using discontiguous templates.
`-B`　N	All programs except "`megablast`"	Number of concatenated queries, in blastn or tblastn mode
`-C`　X	All programs except "`megablast`"	Use composition-based statistics for blastp or tblastn: T, t, D, or d Default (equivalent to 1 for blast2 and blastall_old and to 2 for blastall and blastcl3) 0, F, or f No composition-based statistics 1 Composition-based statistics as in NAR 29:2994-3005, 2001 2 Composition-based score adjustment as in Bioinformatics 21:902-911, 2005, conditioned on sequence properties 3 Composition-based score adjustment as in Bioinformatics 21:902-911, 2005, unconditionally When enabling statistics in blastall, blastall_old, or blastcl3 (i.e., not blast2), appending u (case-insensitive) to the mode enables use of unified p-values combining alignment and compositional p-values in round 1 only.
`-D`　N	All programs except "`megablast`"	Translate sequences in the database according to genetic code N in /usr/share/ncbi/data/gc.prt (default is 1; only applies to tblast*)
`-D`　N	"`megablast`"	Type of output: 0 alignment endpoints and score 1 all ungapped segments endpoints 2 traditional BLAST output (default) 3 tab-delimited one line format 4 incremental text ASN.1 5 incremental binary ASN.1
`-E`　N	"`megablast`"	Extending a gap costs N (-1 invokes default behavior)
`-E`　N	All programs except "`megablast`"	Extending a gap costs N (-1 invokes default behavior: non-affine if greedy, 2 otherwise)
`-F`str	All programs	Filter options for DUST or SEG; defaults to T for bl2seq, blast2, blastall, blastall_old, blastcl3, and `megablast`, and to F for blastpgp, impala, and rpsblast.
`-G`　N	"`megablast`"	Opening a gap costs N (-1 invokes default behavior)
`-G`　N	All programs except "`megablast`"	Opening a gap costs N (-1 invokes default behavior: non-affine if greedy, 5 if using dynamic programming)
`-H`N	"`megablast`"	Maximal number of HSPs to save per database sequence (default is 0, unlimited)
`-I`	All programs	Show GIs in deflines
`-J`	All programs	Believe the query defline
`-K`N	All programs except "`megablast`"	Number of best hits from a region to keep. Off by default. If used a value of 100 is recommended. Very high values of -v or -b are also suggested.
`-L`start, stop	All programs	Location on query sequence (for rpsblast, only valid in blastp mode)
`-M`str	All programs except "`megablast`"	Use matrix str (default = BLOSUM62)
`-M`N	"`megablast`"	Maximal total length of queries for a single search (default = 5000000)
`-N`N	"`megablast`"	Type of a discontiguous word template: 0 coding (default) 1 optimal 2 two simultaneous
`-P`　N	All programs except "`megablast`"	Set to 1 for single-hit mode or 0 for multiple-hit mode (default). Does not apply to blastn.
`-P`　N	"`megablast`"	Maximal number of positions for a hash value (set to 0 [default] to ignore)
`-Q`N	All programs except "`megablast`"	Translate query according to genetic code N in /usr/share/ncbi/data/gc.prt (default is 1)
`-R`	"`megablast`"	Report the log information at the end of output
`-S`N	All programs	Query strands to search against database for blastn, blastx, tblastx: 1 top 2 bottom 3 both (default)
`-T`	All programs	Produce HTML output
`-U`	All programs	Use lower case filtering for the query sequence
`-V`	All programs	Force use of legacy engine
`-W`N	All programs	Use words of size N (length of best perfect match; zero invokes default behavior, except with `megablast`, which defaults to 28, and blastpgp, which defaults to 3. The default values for the other commands vary with "program": 11 for blastn, 28 for `megablast`, and 3 for everything else.)
`-X`N	All programs	X dropoff value for gapped alignment (in bits) (zero invokes default behavior, except with `megablast`, which defaults to 20, and rpsblast and seedtop, which default to 15. The default values for the other commands vary with "program": 30 for blastn, 20 for `megablast`, 0 for tblastx, and 15 for everything else.)
`-Y`X	All programs	Effective length of the search space (use zero for the real size)
`-Z`N	All programs	X dropoff value for final [dynamic programming?] gapped alignment in bits (default is 100 for blastn and `megablast`, 0 for tblastx, 25 for others)
`-b`N	All programs	Number of database sequences to show alignments for (B) (default is 250)
`-e`X		Expectation value (E) (default = 10.0)
`-f`X	All programs except "`megablast`"	Threshold for extending hits, default if zero: 0 for blastn and `megablast`, 11 for blastp, 12 for blastx, and 13 for tblasn and tblastx.
`-f`	"`megablast`"	Show full IDs in the output (default: only GIs or accessions)
`-g`　F	All programs except "`megablast`"	Do not perform gapped alignment (N/A for tblastx)
`-g`　F	"`megablast`"	Make discontiguous `megablast` generate words for every base of the database (mandatory with the current BLAST engine)
`-l`str	All programs	Restrict search of database to list of GI's [String]
`-m`N	All programs	alignment view options: 0 pairwise (default) 1 query-anchored showing identities 2 query-anchored, no identities 3 flat query-anchored, show identities 4 flat query-anchored, no identities 5 query-anchored, no identities and blunt ends 6 flat query-anchored, no identities and blunt ends 7 XML Blast output (not available for impala) 8 tabular (not available for impala) 9 tabular with comment lines (not available for impala) 10 ASN.1 text (not available for impala or rpsblast) 11 ASN.1 binary (not available for impala or rpsblast)
`-n`	All programs except "`megablast`"	`megablast` search
`-n`	"`megablast`"	Use non-greedy (dynamic programming) extension for affine gap scores
`-p`X	"`megablast`"	Identity percentage cut-off (default = 0)
`-q`N	All programs	Penalty for a nucleotide mismatch (blastn only) (default = -10 for seedtop, -3 for everything else)
`-r`N	All programs	Reward for a nucleotide match (blastn only) (default = 10 for seedtop, -10 for everything else)
`-s`	All programs except "`megablast`"	Compute locally optimal Smith-Waterman alignments. For blastall, blastall_old, and blastcl3, this is only available in gapped tblastn mode.
`-s`N	"`megablast`"	Minimal hit score to report (0 for default behavior)
`-t`　N	All programs except "`megablast`"	Length of a discontiguous word template (the largest intron allowed in a translated nucleotide sequence when linking multiple distinct assignments; default = 0; negative values disable linking for blastall, blastall_old, and blastcl3.)
`-t`　N	"`megablast`"	Length of a discontiguous word template (contiguous word if 0 [default])
`-v`N	All programs	Number of one-line descriptions to show (V) (default = 500)
`-w`N	All programs except "`megablast`"	Frame shift penalty (OOF algorithm for blastx)
`-y`X	All programs except "`megablast`"	X dropoff for ungapped extensions in bits (0.0 invokes default behavior: 20 for blastn, 10 for `megablast`, and 7 for all others.)
`-y`N	"`megablast`"	X dropoff value for ungapped extension (default is 10)
`-z`N	All programs	Effective length of the database (use zero for the real size)

Example BLAST program option:

-v 100 -b 100 -e 10 -F F -W 11

Also refer to: BLAST HELP Optional Parameters

format：Response data format

You can specify the following options to select the WABI response data format.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

Response data format	Explanation	Media Type
`text`	Plain text	`text/plain; charset=utf-8`
`json`	JSON format	`application/json; charset=utf-8`
`xml`	XML text	`text/xml; charset=utf-8`
`bigfile`	Used when retrieving data that is output to a file, such as search results as plain text.	`text/plain; charset=utf-8`
`imagefile`	Image data	`image/png`
`requestfile`	Used when retrieving data that is output to a file, such as search results as JSON text.	`application/json; charset=utf-8`

Note: If WABI cannot generate response data in the specified format, then it is considered an invalid input value and returns an HTTP error code.

result：Result retrieval method

The method for retrieving results can be specified from one of the following:
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most recently updated information.

Retrieval Method	Explanation
`www`	Submit a request to a URL for retrieving a result, and receive the result as the response data to the request.
`mail`	Result is sent to the specified email address.

address：Email address

The email address to which the results will be sent.

info：The type of job information being referenced

The following types of information can be retrieved for a submitted search job.
Note: Please use the help API GET /blast/help/{Help-Command} to reference the most up-to-date information.

Information Type	Explanation
`status`	Job status
`result`	Search results
`request`	Search criteria specified when the job was submitted

imageId：The ID of the image associated with a search output

This ID is used to retrieve the image data generated as part of a search.

It is required for the following case:

To retrieve the image data generated by a search.

Example ID for an image generated by search output:

Other Information

Search results are retained for 7 days.
(Refer to “Search result retention period” 「Request ID and BLAST result」)
You can obtain the processed search result at any time during this period by submitting a GET request specifying the Request ID.