BLAST

PROGRAM

Specify the search program from the followings.

Query name, Query sequence

• Please input your sequence(s) in FASTA format.

• You can use either “File Upload” or fill the box directly.

• For multiple query sequence, sequence names to distinguish each sequences are indispensable. Names beginning at “>” should be placed on the first line of each sequence data (multi FASTA format).

• If your query is one sequence, please enter the sequence. Attaching a sequence name is optional. A name beginning at “>” can be attached at the first line.

An example sequence in FASTA format

>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC

Example of multiple query sequence (multi FASTA format)

>>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
>my query sequence 2
GGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCGCTTCCCAGGCAACCTGCCTCACATG
CTTCGAGACCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAG
CTGGACAACATATTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAG
>my query sequence 3
ATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCAAC
TTTGCCCACGGACACAACTGCCATATCGCCTTACGGGAGATCATCGAAACTCTGAACAGC
CTCACAGAGCAGAAGACTCTGTGCACCAAGTTGACCATAACGGAC

Data Sets {#data sets}

Nucleotide (DATABASE, DIVISION)

DATABASE (Nucleotide)

Select the target database.

DIVISION (DDBJ ALL/DDBJ New) {#DIVISION_DDBJ_ALL/DDBJ_New}

Check the divisions you would like to search. The following divisions are currently available. Default selection is 10 divisions of standard divisions (excl. SYN and ENV).
Especially for EST division, the following 21 listed organisms which were selectted based on the submitted-number’s statistics can be specified each other.

Database Options (RefSeq)

Protein (amino acid)

DATABASE (protein)

* Please check the current version is from here.

DIVISION(DAD)

Check the divisions you would like to search. The following divisions are currently available. Defauls selection is 10 divisions of standard divisions (excl. SYN and ENV). Especially for EST division, the following 21 listed organisms which were selectted based on the submitted-number’s statistics can be specified each other.

DATABASE option (RefSeq)

Optional Parameters

SCORES

Specify how many homologous sequences are reported in list of homology scores. Default value is 100.
When you can not find some expected data in the result of BLAST search, it is possibly improved by using larger value for this parameter.

ALIGNMENTS

Specify how many alignments with homologous sequences are reported.
Default value is 100.
When you can not find some expected data in the result of BLAST search, it is possibly improved by using larger value for this parameter.

EXPECT value (E-value) {#expect value}

Specify the E-value of homologous sequences in the database. Default value is 10. If you need to get more sequences with lower homology score, increase the “expect value”. If you need only sequences with very high homology scores, decrease the value.
It is possible to specify it by the exponent notation. (ex: 1.0E+1)

SCORING MATRIX {#scoring matrix}

Specify the scoring matrix table for blastx, blastp and tblastn and tblastx.
The default matrix is BLOSUM62.

FILTER

Specify to preform filtering (masking) of the query sequence. Default setting of this option is “ON” (filtering is set). By using filtering, low compositional complexity regions in your query sequence are ignored.
For example, proline-rich regions and poly-A tails have a tendency to coincide with an unusually high score. Although statistically significant, such results usually reflect the structural uniqueness of these regions and are unlikely to be biologically significant.
The query sequence is filtered by the computer program DUST of Tatusov and Lipman in BLASTN, and by SEG of Wootton and Federhen otherwise. Low compositional complexity regions ignored by filtering are replaced by “N”s in the nucleotide sequence and by “X”s in the amino acid sequence.

WORD SIZE {#word size}

Specify a natural number. Default values are 28 for megablast, 11 for blastn, and 3 for the other programs.

Request ID and BLAST result

Request ID {#request id}

After pressing the “Send to BLAST” button, Request ID is displayed on the web screen. Don’t loose this ID because it is necessary for using the “Result Viewer” and/or inquiring to DDBJ for your search.

Request ID:wabi_blast_2013-0314-1407-23-16-946732

Information contained in the result screen {#result screen}

View the flatfile of the entries {#view flatfile}

Select the accession numbers, and prres the “getentry”button. You can view the flatfile of the sequences in the getentry.

Result Viewer {#result viewer}

You can view your result using “Request ID” at any time (within the retention period).
The results will be deleted after 7 days.

ClustalW Set up

Select the sequences which you would like to suceed the clustalW, then press the “ClustalW” button. Your selected sequences are automatically pasted in the ClustalW query box.

1. 2.

Reference

Original Articles

• Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25(17):3389-3402.

Related Articles

• Zhang J, Madden TL. (1997) PowerBLAST: A New Network BLAST Application for Interactive or Automated Sequence Analysis and Annotation. Genome Res.7(6):649-656.
• Madden TL, Tatusov RL, Zhang J. (1996) Applications of network BLAST server. Methods Enzymol. 266:131-141.
• Gish W, States DJ. (1993) Identification of protein coding regions by database similarity search. Nat Genet. 3(3):266-272.
• Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. (1990) Basic local alignment search tool. J Mol Biol. 215(3):403-10.
• Karlin S, Altschul SF. (1990) Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc Natl Acad Sci U S A. 87(6):2264-2268.

BOOK {##reference_list}

• [BLAST] Ian Korf, Mark Yandell and Joseph Bedell, OREILLY