• (August 14 to 17) DDBJ Center Closing for Summer Break
  • Revision of the Terms of Use (Access and Benefit-Sharing)

BLAST

  • Home
  • services
  • BLAST

PROGRAM

Specify the search program from the followings.

PROGRAM query Data Base Description       
megablast nucleotide nucleotide Aligning your nucleotide sequence with nucleotide sequence database.
When you want to perform a homology search with long length of nucleotide sequence, results are provided faster than blastn program.
 
blastn nucleotide nucleotide Aligning your nucleotide sequence with nucleotide sequence database.  
tblastn amino acid nucleotide Aligning your amino acid sequence with nucleotide sequence database by translating database sequences taking into account all six possible open reading frames.  
tblastx nucleotide nucleotide Aligning your nucleotide sequence with nucleotide sequence database by translating both sequences taking into account all six possible open reading frames.  
blastp amino acid amino acid Aligning your amino acid sequence with amino acid seque nce database.  
blastx nucleotide amino acid Aligning your nucleotide sequence with amino acid sequence database by translating your sequence taking into account all six possible open reading frames.  

Query name, Query sequence

  • Please input your sequence(s) in FASTA format.

  • You can use either “File Upload” or fill the box directly.

  • For multiple query sequence, sequence names to distinguish each sequences are indispensable. Names beginning at “>” should be placed on the first line of each sequence data (multi FASTA format).

  • If your query is one sequence, please enter the sequence. Attaching a sequence name is optional. A name beginning at “>” can be attached at the first line.

An example sequence in FASTA format

>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC

Example of multiple query sequence (multi FASTA format)

>>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
>my query sequence 2
GGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCGCTTCCCAGGCAACCTGCCTCACATG
CTTCGAGACCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAG
CTGGACAACATATTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAG
>my query sequence 3
ATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCAAC
TTTGCCCACGGACACAACTGCCATATCGCCTTACGGGAGATCATCGAAACTCTGAACAGC
CTCACAGAGCAGAAGACTCTGTGCACCAAGTTGACCATAACGGAC
When your query size is too big (a large number of sequences, or each sequence is very long), the result might not be viewed in the web screen normally. In such a case, please reduce the query size to send it at one time, decreasing the number of sequences or shortening the the sequence lengths.

Data Sets {#data sets}

Nucleotide (DATABASE, DIVISION)

DATABASE (Nucleotide)

Select the target database.

nucleotide database  
DDBJ ALL DDBJ periodical release + daily updates
DDBJ New DDBJ daily updates
16S rRNA 16S rRNA from DDBJ periodical release
RefSeq NA RefSeq (Genomics + RNA)

DIVISION (DDBJ ALL/DDBJ New) {#DIVISION_DDBJ_ALL/DDBJ_New}

Check the divisions you would like to search. The following divisions are currently available. Default selection is 10 divisions of standard divisions (excl. SYN and ENV).
Especially for EST division, the following 21 listed organisms which were selectted based on the submitted-number’s statistics can be specified each other.

Standard divisions    
Human HUM human
Primates PRI primates other than human
Rodents ROD rodents
Mammals MAM mammals other than human, primates and rodents
Vertebrates VRT vertebrates other than human, primates, rodents and mammals
Invertebrates INV invertebrates
Plants PLN plants
Bacteria BCT bacteria
Viruses VRL viruses
Phages PHG phages
Synthetic DNAs SYN synthetic DNAs
ENV ENV environmental samples
High throughput divisions    
HTC HTC High Throughput cDNAs
HTG HTG High Throughput Genomic sequences
TSA TSA Transcriptome Shotgun Assembly
EST divisions  
A.thaliana Arabidopsis thaliana (thale cress)
B.taurus Bos taurus (cattle)
C.elegans Caenorhabditis elegans (nematode worm)
C.reinhardtii Chlamydomonas reinhardtii (Chlamydomonas:green algae)
C.intestinalis Ciona intestinalis (vase tunicate)
D.rerio Danio rerio (zebrafish)
D.discoideum Dictyostelium discoideum (soil-living amoeba)
D.melanogaster D.melanogaster (fruit fly)
G.gallus Gallus gallus (chicken)
G.max Glycine max (soybean)
H.sapiens Homo sapiens (human)
H.vulgare Hordeum vulgare (incl. subspecies)
M.truncatula Medicago truncatula (incl. mixed library)
M.musculus Mus musculus (Mouse)
O.sativa Oryza sativa (incl. subspecies rank)
R.norvegicus Rattus norvegicus (incl. Rattus sp.)
S.lycopersicum Solanum lycopersicum (tomato)
T.aestivum Triticum aestivum (bread wheat)
X.laevis Xenopus laevis (african clawed frog)
X.tropicalis Xenopus tropicalis (western clawed frog)
Z.mays Zea mays (maize)
Others Others
Other divisions    
Patent PAT patent
Unannotated Seq UNA unannotated sequences
GSS GSS genome survey sequences
STS STS sequence tagged sites

Database Options (RefSeq)

Release(genomic/RNA)  
Fungi Fungi
Invertebrate Invertebrate
Microbial Microbial
Mitochondrion Mitochondrion
Plant Plant
Plasmid Plasmid
Plastid Plastid
Protozoa Protozoa
Vertebrate Mammalian Vertebrate Mammalian
Vertebrate Other Vertebrate Other
Viral Viral
Daily Updates Daily Updates
Model(Genomic)  
H. sapiens human
Model(RNA)  
B. taurus cattle
D. rerio zebrafish
H. sapiens human
M. musculus mouse
R. norvegicus rat
X. tropicalis western clawed frog

Protein (amino acid)

DATABASE (protein)

Proterin Databases  
UniProt (Swiss-Prot + TrEMBL) Swiss-Prot + TrEMBL
UniProt (Swiss-Prot) Swiss-Prot
UniProt (TrEMBL) TrEMBL
Patent amino acid patent data via JPO, EPO, USPTO and KIPO
(When you check the “Patent”, all 4 boxes (JPO, KIPO, USPTO, EPO) was checked.
If you would like to select each other, remove the unnecessary marks.)
DAD (periodical release + daily updates) DAD periodical release + daily updates
DAD (daily updates) DAD daily updates
RefSeq AA Refseq(Protein)

* Please check the current version is from here.

DIVISION(DAD)

Check the divisions you would like to search. The following divisions are currently available. Defauls selection is 10 divisions of standard divisions (excl. SYN and ENV). Especially for EST division, the following 21 listed organisms which were selectted based on the submitted-number’s statistics can be specified each other.

Standard divisions    
Human HUM human
Primates PRI primates other than human
Rodents ROD rodents
Mammals MAM mammals other than human,primates and rodents
Vertebrates VRT vertebrates other than human,primates, rodents and mammals
Invertebrates INV invertebrates
Plants PLN plants
Bacteria BCT bacteria
Viruses VRL viruses
Phages PHG phages
Synthetic DNAs SYN synthetic DNAs
ENV ENV environmental samples
High throughput divisions    
HTC HTC High Throughput cDNAs
HTG HTG High Throughput Genomic sequences
TSA TSA Transcriptome Shotgun Assembly
EST divisions  
A.thaliana Arabidopsis thaliana (thale cress)
B.taurus Bos taurus (cattle)
C.elegans Caenorhabditis elegans (nematode worm)
C.reinhardtii Chlamydomonas reinhardtii (Chlamydomonas:green algae)
C.intestinalis Ciona intestinalis (vase tunicate)
D.rerio Danio rerio (zebrafish)
D.discoideum Dictyostelium discoideum (soil-living amoeba)
D.melanogaster D.melanogaster (fruit fly)
G.gallus Gallus gallus (chicken)
G.max Glycine max (soybean)
H.sapiens Homo sapiens (human)
H.vulgare Hordeum vulgare (Barley incl. subspecies)
M.truncatula Medicago truncatula(Barrel Medic incl. mixed library)
M.musculus Mus musculus (Mouse)
O.sativa Oryza sativa (incl. subspecies rank)
R.norvegicus Rattus norvegicus (Rat incl. Rattus sp.)
S.lycopersicum Solanum lycopersicum (tomato)
T.aestivum Triticum aestivum (bread wheat)
X.laevis Xenopus laevis (african clawed frog)
X.tropicalis Xenopus laevis (african clawed frog)
Z.mays Zea mays (maize)
Others Others
Other divisions    
Patent PAT patent
Unannotated Seq UNA unannotated sequences
GSS GSS genome survey sequences
STS STS sequence tagged sites

DATABASE option (RefSeq)

Release(Protein)  
Fungi Fungi
Invertebrate Invertebrate
Microbial Microbial
Mitochondrion Mitochondrion
Plant Plant
Plasmid Plasmid
Plastid Plastid
Protozoa Protozoa
Vertebrate Mammalian Vertebrate Mammalian
Vertebrate Other Vertebrate Other
Viral Viral
Daily Updates Daily Updates
Model(Genomic)  
H. sapiens human
Model(Protain)  
B. taurus cattle
D. rerio zebrafish
H. sapiens human
M. musculus mouse
R. norvegicus rat
X. tropicalis western clawed frog

Optional Parameters

SCORES

Specify how many homologous sequences are reported in list of homology scores. Default value is 100.
When you can not find some expected data in the result of BLAST search, it is possibly improved by using larger value for this parameter.

ALIGNMENTS

Specify how many alignments with homologous sequences are reported.
Default value is 100.
When you can not find some expected data in the result of BLAST search, it is possibly improved by using larger value for this parameter.

EXPECT value (E-value) {#expect value}

Specify the E-value of homologous sequences in the database. Default value is 10. If you need to get more sequences with lower homology score, increase the “expect value”. If you need only sequences with very high homology scores, decrease the value.
It is possible to specify it by the exponent notation. (ex: 1.0E+1)

SCORING MATRIX {#scoring matrix}

Specify the scoring matrix table for blastx, blastp and tblastn and tblastx.
The default matrix is BLOSUM62.

PAM30 PAM30 substitution matrix
PAM70 PAM70 substitution matrix
PAM250 PAM250 substitution matrix
BLOSUM45 BLOSUM Clustered Scoring Matrix
BLOSUM50 BLOSUM Clustered Scoring Matrix
BLOSUM62 BLOSUM Clustered Scoring Matrix
BLOSUM80 BLOSUM Clustered Scoring Matrix
BLOSUM90 BLOSUM Clustered Scoring Matrix

FILTER

Specify to preform filtering (masking) of the query sequence. Default setting of this option is “ON” (filtering is set). By using filtering, low compositional complexity regions in your query sequence are ignored.
For example, proline-rich regions and poly-A tails have a tendency to coincide with an unusually high score. Although statistically significant, such results usually reflect the structural uniqueness of these regions and are unlikely to be biologically significant.
The query sequence is filtered by the computer program DUST of Tatusov and Lipman in BLASTN, and by SEG of Wootton and Federhen otherwise. Low compositional complexity regions ignored by filtering are replaced by “N”s in the nucleotide sequence and by “X”s in the amino acid sequence.

WORD SIZE {#word size}

Specify a natural number. Default values are 28 for megablast, 11 for blastn, and 3 for the other programs.

Request ID and BLAST result

Request ID {#request id}

After pressing the “Send to BLAST” button, Request ID is displayed on the web screen. Don’t loose this ID because it is necessary for using the “Result Viewer” and/or inquiring to DDBJ for your search.

Request ID:wabi_blast_2013-0314-1407-23-16-946732

blast_requestID

Information contained in the result screen {#result screen}

View the flatfile of the entries {#view flatfile}

Select the accession numbers, and prres the “getentry”button. You can view the flatfile of the sequences in the getentry.

View the flatfile of the entries

Result Viewer {#result viewer}

You can view your result using “Request ID” at any time (within the retention period).
The results will be deleted after 7 days.

Result Viewer

ClustalW Set up

Select the sequences which you would like to suceed the clustalW, then press the “ClustalW” button. Your selected sequences are automatically pasted in the ClustalW query box.

1. 2.

Reference

Original Articles

  • Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25(17):3389-3402.

Related Articles

  • Zhang J, Madden TL. (1997) PowerBLAST: A New Network BLAST Application for Interactive or Automated Sequence Analysis and Annotation. Genome Res.7(6):649-656.
  • Madden TL, Tatusov RL, Zhang J. (1996) Applications of network BLAST server. Methods Enzymol. 266:131-141.
  • Gish W, States DJ. (1993) Identification of protein coding regions by database similarity search. Nat Genet. 3(3):266-272.
  • Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. (1990) Basic local alignment search tool. J Mol Biol. 215(3):403-10.
  • Karlin S, Altschul SF. (1990) Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc Natl Acad Sci U S A. 87(6):2264-2268.

BOOK {##reference_list}

  • [BLAST] Ian Korf, Mark Yandell and Joseph Bedell, OREILLY

Related pages

  • ARSA Help
  • getentry Help
  • TXSearch Help
  • ClustalW Help
  • VecScreen Help
  • References
  • Services in past
  • WABI (Web API for Biology)
  • WABI BLAST Help