Last updated:2014.6.23.

FAQ

Keyword Search

Tag Search(NSSS:DDBJ Nucleotide Sequence Submission System , MSS:Mass Submission System)

All FAQs 139
Though I am not the original submitter of the sequence data, can I correct an error in the data? update

In principle, DDBJ only accepts updating requests from the original submitter of the entry except reference update. Therefore, if you are not the submitter you will need authorization from the submitter before making requests for the entry.
DDBJ can forward your comments and suggestions to the submitter.
Please contact us via Inquiry to the sequence submitters (submitted to DDBJ).

Last Updated:July 3, 2014
Before the hold date, how can we confirm contents of the data? update

We only accept this kind of request from the original submitter of the entry.
Please contact us from contact form by selecting the item, "Updating Submitted Data" with accession numbers.

Last Updated:July 3, 2014
Can we update submitted data with DDBJ Nucleotide Sequence Submission System? NSSS update

Since DDBJ Nucleotide Sequence Submission System can be only used for new submissions, you can not update submitted data with the system.
For update, see Data Updates/Corrections.

Last Updated:June 9, 2014
Lost correspondence of sequence data submitted as "Hold-Until-Published" status update

Please contact us from contact form by selecting the item, "Updating Submitted Data" with following items;

  • E-mail address of contact person
  • Accession numbers or EntryIDs

We will reply with contents of your data.

Last Updated:July 3, 2014
When our paper was published, what should I do? update

Contact us from this form with "Our paper was published" in [Subject].

Last Updated:June 15, 2017
When our paper was accepted, what should I do? update

Contact us from this form with "Our paper was accepted" in [Subject].

Last Updated:June 15, 2017
How to postpone the hold date? update

Contact us from this form by selecting "Change the hold-date" in [Subject].

Last Updated:June 15, 2017
How to change the contact person, belonging, institution, etc.. update

Contact us from this form with "Change the contact person, belonging, institution, etc.." in [Subject].

Last Updated:June 15, 2017
How to update our sequence? update

Please send your request to ddbjupdt#64;ddbj.nig.ac.jp with the following contents in clear English.

  • Accession numbers:
  • The modified part:
  • Total base count:
  • Other modified feature:
  • Updated sequence in full length: Please use the following format.
>AB*****1
aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt
ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc
//
>AB*****2
aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt
ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc
aaaaaaaaaat
//
  • Header line; starts with ">", followed by the accession number at the head of each sequence.
  • Sequence; each line must be 60 letters or less.
  • End line; end flag, "//", must be at the end of each sequence.
Last Updated:June 16, 2017
How to update many entries with a number of corrections? update

If you are making update request for large number of entries, or many changes of features/locations/qualifiers due to sequence modification, see followings.

(1) Update information is in common of all entries.
Example: change reference or submitters information, postpone the hold-date, etc..

In principle, send your request via Application Form for Data Update Requests.

 

(2) Contents of corrections are different among entries.
Example: change each clone or gene name of all entries, etc..
(3) Extensive correction of data
Example: change more than 30 features due to the sequence update, etc..

In case of (2) or (3), we would like to know the number of entries, the correction item, etc. to specify the file format for your request.
Contact us by mail to ddbjupdt#64;ddbj.nig.ac.jp to consult in advance.
In general, we handle update requests within several days but for a large number of entries, it might take us time in updating the data.
Be sure to contact us beforehand when you request the release of data which accompanies correction.

Last Updated:June 19, 2017
Can I confirm previous version of the sequence data? getentry search update

Previous versions of sequence data are available by using getentry webAPI.

See gethistory on getentry HELP.

Last Updated:June 25, 2014
On the process of submission of a paper to a journal, we have to show the referee our nucleotide sequence submitted as "Hold-Until-Published" status... update

DDBJ does not provide any procedure for a limited disclosure by the password authentication or else.
When you have to show your sequence data submitted with "Hold-Until-Published" status for only particular individuals, you can send as a text file including your sequences to them.
If the referee wish to confirm the condition and/or the descriptions of your sequence submission, you can choose either of the following two procedures;

a) Publish your sequences through DDBJ.
If you do not mind to open your sequences to the public, please send us your request to publicize your submitted sequences with all of accession numbers.
b) Send DDBJ flat files of your submission to the referee, directly
When the submitter requests to us, we send the text file including DDBJ flat files to the submitter. So, please send us your request with all of accession numbers to get DDBJ flat file(s) of your submission. Then, you can forward the text file to the referee.

Contact us by mail to ddbjupdt#64;ddbj.nig.ac.jp, if necessary.

Last Updated:June 16, 2017
When updating published sequence data, can I hold updated version in the mean time? update

DDBJ does not accept any reservation for updating sequence data.
Therefore, in case of updating published data, the data will be immediately re-distributed after update.

Please select either of following ways.

  • In this time, canceling the request for update, when you can publish updated data, contact us again.
  • Submit the updated data as a new data with hold date. When the new data is published, the accession number of the old data will become a secondary accession number for the new data.
    # Please inform us during submitting the new data to link it to the old data.
Reference
Last Updated:June 13, 2014
How to restore the released data to private? update

In principle, DDBJ can not restore any published data.
See also following item about access restriction.

In principle, you cannot remove your sequence data from DDBJ retrieval system: getentry, if it has already been open to the public (If DDBJ wrongly published your data because of any mistakes, the data should be removed as soon as possible.).

However, if there is some specific reason for removing your sequence data (i.e. some error is found, etc.), we can restrict access to your sequence data.

Please send your request to ddbjupdt#64;ddbj.nig.ac.jp with the following contents.

  • Accession numbers:
  • Reason in brief:
  • New hold-date: (e.g. 2019/06/25)

If we restrict access to your sequence data and remove it from the public view, then it will no longer be included in homology search services at DDBJ or distributed as a part of the next DDBJ periodical release. However, it may remain in other third party databases, and will still be retrievable in getentry by accession number based queries.

Moreover, our unified database may be copied and redistributed without permission at any other organizations. In case you need to withdraw your entry from such database, we ask you to make request directly to the organization which manages the database.

References
Why is the retracted data still available?
INSDC Status Document
Last Updated:June 19, 2017
How to delete my data? submission update

In principle, following two conditions are required to delete your sequence data;

1) The sequence data has not yet been publicized
2) The accession number of the data has not yet been published.

Please send your request to ddbjupdt#64;ddbj.nig.ac.jp with the following contents in clear English.

  • Accession numbers:
  • Reason in brief:

Just for information, we can restrict access to your sequence data that have been open to the public, if the conditions are right.
See also the following item.

References
How to restore the released data to private?
Why is the retracted data still available?
INSDC Status Document
Last Updated:June 16, 2017
What kinds of data are acceptable at DDBJ? category submission

See Categories for Sequence Data.

If you are not sure to which category your sequence data should be submitted, see followings;

If you still have any question, please contact us from contact form by selecting the item, "Data Submission".

Last Updated:July 3, 2014
How to submit only annotation for previously reported sequences? format submission

If your annotation meets the requirements of TPA Submission Guidelines, DDBJ can accept it as TPA (Third Party Data).

Last Updated:August 27, 2014
How to submit sequence data with annotation to DDBJ? category format MSS NSSS submission

Select from following two ways.

In general, we recommend to use DDBJ Nucleotide Sequence Submission System
In cases of, large number of sequences, many features, and/or long sequences, MSS is more useful.

Last Updated:June 16, 2014
How to submit amino acid sequences? category submission

In general, you can submit amino acid sequences by describing CDS feature for your nucleotide sequences.
However, DDBJ does not accept amino acid sequences only, i.e. without any nucleotide sequences.
In that case, please submit to UniProt, directly.
You can submit amino acid sequences to UniProt through SPIN.
Please contact to datasubs@ebi.ac.uk.

Last Updated:November 26, 2014
How can I get protein_id? submission

The protein_id will be automatically assigned at DDBJ during release of your nucleotide sequence with CDS feature.

Last Updated:July 3, 2014
How to submit assembled EST sequences? category submission

DDBJ can not accept only assembled EST sequences. However, DDBJ can accept EST assembled sequences as TSA with original (i.e. before assemble) sequence data. See also Data Submission form Transcriptome Project.
When original sequence data (primary entries) are generated from Next Generation Sequencers, submit to DDBJ sequence Read Archive (DRA), from traditional sequencers, submit as EST via Mass Submission System (MSS).
Then, DDBJ can accept assembled sequences (both de novo and reference mapping) as TSA through MSS.

Last Updated:June 16, 2014
How to describe organism name, if the species is not identified or not defined? format MSS NSSS submission
Last Updated:June 16, 2014
How to submit sequence data directly obtained from soil or sea water? format MSS NSSS submission

In cases of sequences derived by direct molecular isolation from soil, sea water, etc. i.e. a bulk environmental DNA sample by PCR with or without subsequent cloning of the product, DGGE, or other anonymous methods, see What is ENV ? – environmental samples.
For description of organism qualifier, see 3. Environmental samples.

Though frequently confused, the term, 'environmental samples', does NOT mean "wild type". If sequences are derived from isolated or cultured organisms, the sequence data are not classified into environmental samples.

Last Updated:June 16, 2014
How to describe organism name for artificially constructed sequence? format MSS NSSS submission
Last Updated:June 16, 2014
How to descrbe the evidence of speculation for the feature? format MSS NSSS submission

You can use experiment or inference qualifier to describe evidence of speculation in each feature.

Last Updated:June 16, 2014
How to submit sequence data determined by Next Generation Sequencers? category submission

See Categories for Sequence Data.
Please submit raw reads generated from Next Generation Sequencers to DDBJ sequence Read Archive.
See also Data Submission from Genome Project or Data Submission from Transcriptome Project.
Please submit assembled sequences through Mass Submission System, if necessary.

Last Updated:June 16, 2014
How to submit sequence-based expression data like as RNA seq? category submission

Please submit raw reads of sequence-based expression data to DDBJ Sequence Read Archive.

Last Updated:June 16, 2014
How to submit sequence data related to Barcode of Life (BoL)? format submission

For sequence data related to Barcode of Life project, please submit via DDBJ Nucleotide Sequence Submission System or Mass Submission System.
For chromatograms (traces), please submit to DDBJ Trace Archive

Last Updated:June 18, 2014
Should we send offprint related to our sequence data? submission update

Generally, DDBJ do not need any offprint to process your data.
Occasionally, DDBJ may contact the submitter of sequence data to ask sending an offprint, if necessary.

Last Updated:June 18, 2014
We would like to quote the article of DDBJ. analysis search
When you kindly describe about using DDBJ on academic papers etc., please use the following article.
In general, it is the latest article related to DDBJ on Nucleic Acids Res. Database issue. When you want to know the article about the service of the DDBJ, please refer to How to Use DDBJ.
Last Updated:June 16, 2017
Should we submit both genomic and mRNA sequences of the same gene to DDBJ? submission

Basically, please submit every sequence that you have experimentally determined, whatever the resource of genome, mRNA or any others.
In principle, DDBJ accepts submission of experimentally determined sequence in its contiguous structure.
You can describe mRNA feature, CDS feature and so on as annotation for genomic sequence, however, descriptions of mRNA features do not mean "the mRNA sequence is experimentally determined.", in general.
If you have read mRNA sequences, please submit mRNA sequences to DDBJ. See also Acceptable data for DDBJ.

Last Updated:June 19, 2014
Can I submit seuqence data without any published paper, during writing or in press? MSS NSSS submission

Yes you can. It ought to be required at 'instructions to authors' of most of journals to submit sequence data to DDBJ (, EMBL-Bank or GanBank) before the paper submission.
During submission of sequence data, select status for your REFERENCE as follows.

  • "Unpublished"; In cases of preparing paper, during paper submission, or you do not prepare any publication.
  • "In Press"; When your paper is accepted and in press.

Your citations will be appeared at REFERENCE 2 or after on DDBJ flat file.

Last Updated:June 19, 2014
When we have no plan to paper publication, how to describe REFERENCE? format MSS NSSS submission

Regardless you are to publish academic paper or not, DDBJ accepts your submission of sequence data.
If you have no plan to paper publication, you have to fill following items of REFERENCE.

  • status: [Unpublished]
  • year: tentative year (this year), i.e. 2014
  • title: tentative title to explain your data
  • ab_name (authors): abbreviation of tentative author(s) (often the same as ab_name of SUBMITTER)

When you change your plan after sequence data submission, i.e. if you publish a paper, contact us from this form to send request with subject "Our paper was published".

Last Updated:June 16, 2017
Do we have to submit sequence data to DDBJ, when the journal has no requirement to do so? submission

Though there is no requirement to submit sequence data to DDBJ (, EMBL-Bank or GenBank) on the journal, we strongly recommend to submit sequence data to DDBJ for improvement of data availability for readers of your paper.

References
Last Updated:June 19, 2014
Is it OK to submit sequence data by only one submitter? format MSS NSSS submission

DDBJ accepts updating requests only from the original submitter of the entry.
Basically, we strongly recommend to describe joint submitters more than two persons, e.g. at least a true worker and an adviser, to avoid lost communication in future.

See Required items for nucleotide sequence submission.

Last Updated:June 19, 2014
Should I submit sequence data to GenBank? submission

When sequence data are published, the data will be shared among DDBJ, EMBL-Bank and GenBank. So, it is necessary and sufficient to submit sequence data to either of three data banks only once.
If you submit sequence data to GenBank after submission of the same data to DDBJ, the data will be duplicated. So, do not submit the same data to two or more data banks.

Though some journals instruct to authors to submit sequence data to GenBank, Accession Number is commonly used by all of DDBJ, EMBL-Bank and GenBank to construct INSD.

Last Updated:July 3, 2014
Can we submit sequence data related to patent application? submission

Nucleotide sequence data related to patent applications are transferred from Japan Patent Office to DDBJ.
So, usually, you do not have to submit such sequence data to DDBJ.

However, if you apply to any other Patent Office, or if you need to publish a paper during patent application, confirm at Patent Office whether you can submit the data to DDBJ or not.

Note that when the sequence data is published from DDBJ, the data becomes a part of the public domain, as "official notice".

References
Sequence data included in patent applications
Patent, Intellectual Property and Priority
Patent column from DDBJ
Last Updated:May 26, 2015
If I submit sequence data to DDBJ, can I get priorities for the data? submission

If you submit nucleotide sequence data to DDBJ, you can get NO priority for the data.
DDBJ takes no responsibility for any property or priority issues for patenting. For patent application, you should confirm JPO or some other Patent Offices.

References
Last Updated:May 26, 2015
If I submit sequence data with gene and protein names, will the names become official? submission

DDBJ does not have any right for the gene nomenclature. Also, DDBJ does not make any official collaboration with any committee of gene nomenclature. If there is no particular incident, the descriptions related to gene nomenclature are described as provided by submitter.
Even if you name a gene during your sequence data submission to DDBJ, there is no guarantee that the gene name is accepted at research communities.

References

You should confirm each gene nomenclature committee, i.e. HUGO Gene Nomenclature Committee (HGNC) for human, MGI - Mouse Nomenclature for mouse, and so on.

Last Updated:May 26, 2015
How to describe a base substitution that causes an amino acid substitution? format NSSS submission

In general, you can describe base substitutions by using variation feature with replace and note qualifiers.
In case of using DDBJ Nucleotide Sequence Submission System, select 'other' for template.
About format of feature annotation, see F01) polymorphism and variation at Example of Submission.

Last Updated:June 26, 2014
After submission of SNP data to DDBJ, will it automatically reflect to dbSNP? format submission

Though you can submit sequence data including SNP (Single Nucleotide Polymorphisms) to DDBJ, the data will not automatically reflect to dbSNP.
dbSNP is an independent database from INSDC, operated by NCBI.
For SNP data, we recommend you to submit to dbSNP.

In case of submission to DDBJ, see format of feature annotation at B13) polymorphism and variation on Example of Submission.

References
Where to submit variation data, such as single nucleotide variations, structural variations, copy number variations (CNVs) and so on?
How to submit sequence data related to DNA polymorphism?
Last Updated:February 26, 2016
In a circular genome, when a feature is located in the base range joined from the last base to the first base, how to describe the location of the feature? format MSS NSSS submission

For instance, when the length of sequence is 199035 bp and a CDS feature is located in the range from 199001 to 100, you should describe the location of CDS feature as
join(199001..199035,1..100)
See also Description of Location in detail.

Last Updated:June 30, 2014
To submit a complete sequence of a genome, are annotation data for the genome required? format MSS submission

As feature annotation, we strongly recommend you to describe CDS (protein-coding sequence)rRNAtRNA and so on.
Please inform us in detail, when you apply to Mass Submission System.

Last Updated:June 15, 2017
When the correspondences between nucleotides and amino acids are different from the standard genetic code, how to describe CDS feature? format submission

At first, please confirm whether The Genetic Code is appropriately selected or not.
Generally, if /transl_table qualifier is appropriately described with a number of the genetic code, the nucleotide sequence is automatically translated to amino acid sequence according to the genetic code.

In exceptional cases of specific codons (selenocysteine etc.) that is not followed the genetic codes, describe /transl_except qualifier, appropriately.

In cases of RNA editing,ribosomal frameshiftmitochondrial TAA stop codon, see Example of submission and describe with /exception and /translation, /ribosomal_slippage, /transl_except, respectively.

In case of rare initiation of translation, staring with an amino acid other than methionine, describe the location of CDS feature with starting from "<", operatively indicating 5'end not complete. And describe brief explanation about the translation mechanism in /note qualifier.

Last Updated:June 30, 2014
Who should be the Contact person? format submission

See Contact person.
If your affiliation was changed after sequencing or when you belong two or more institutes, please describe the most responsible one as a representative.

Last Updated:June 30, 2014
How to describe a submiter or an author who has first name only? format MSS NSSS submission
In case of Mass Submission System
Describe first name, only.
Though some warning will be outputted, please ignore them.
In case of Nucleotide Sequence Submission System
Please enter first name with some dummy initial.
Please inform us about the person with "Submission Information" on Final confirmation screen.
Last Updated:June 30, 2014
How to contact the submitter of sequence data? format search

Since 2007, we have removed E-mail addresses and phone numbers from sequence data.
If you can find a related paper at REFERENCE on DDBJ flat file, contact information would be available on the paper.
When you wishes to contact to the submitter(s) of an entry of your interest, please contact us via Inquiry to the sequence submitters (submitted to DDBJ) with reasons briefly, then we will forward your message to the submitter(s).

Last Updated:June 30, 2014
I have not yet received accession number, how many days does it take to get accession number? NSSS submission

In principle, accession numbers will be acknowledged to contact person via e-mail (with Subject: "[DDBJ] Assigned Accession No.") within 5 working days (i.e. except holidays) after DDBJ accepting submitted data.
See DDBJ Calendar about working days of DDBJ Center.
When you do not receive accession numbers or inquiry about your data from DDBJ within 5 working days after your data submission, please contact us from contact form by selecting the item, "Data Submission".

To make sure, Do not block E-mails from DDBJ.

In case of using DDBJ Nucleotide Sequence Submission System, please confirm if you have received a mail from DDBJ with "DDBJ: Web submission completed" in its subject or not. This mail is automatically sent to contact person, when DDBJ accepts your sequence data via Nucleotide Sequence Submission System.

If you have NOT received the mail,
Your submission is not yet finished, so, please complete your submission.
If you have received the mail,
please contact us from contact form with contact person E-mail address and EntryID of your data by selecting the item, "Data Submission".
Last Updated:July 3, 2014
Is there any case to reject submission to DDBJ? submission

See Acceptable data for DDBJ.
If you have any question, please contact us from contact form.

Reference
Is there any restriction of sequence length to submit to DDBJ?
Last Updated:February 26, 2016
I lost my accession number submission update

If you have specific ID for your data other than accession number, such as EntryID or any, contact us from contact form by selecting the item, "Updating Submitted Data", with ID and E-mail address of contact person.
In case of uncertain, tell us following items as far as you know, then we will search your data.

  • Your name
  • Your affiliation at the time of submission
  • Your current affiliation
  • Your mail address at the time of submission
  • Your current mail address
  • The date, month and/or year, when you submit your data
  • Tool that you used to submit your sequence
  • Your sequence(s) (if many, just a few representatives)
  • Biological feature of your sequence

When we can not find your data, we will ask you to submit your data as new one.

Last Updated:July 3, 2014
How to describe accession numbers on the academic paper? search submission

In general, see the rule of the journal (i.e. Instructions to Authors), and follow it.
At INSDC, we recommend you to describe accession numbers in the footnote on the title page of your paper as following;
Note: Nucleotide sequence data reported are available in the DDBJ/EMBL/GenBank databases under the accession number(s)----'.

Last Updated:July 2, 2014
What is the date in LOCUS line? format search

It is the date of the last release of the data. See LOCUS of Explanation of DDBJ flat file format.

Last Updated:July 2, 2014
What is "Direct Submission" in TITLE of REFERENCE 1? search submission

It indicates that this data is directly submitted from the submitter. The term is the antonym to "journal scan".
REFERENCE 1 is the information of submitter(s), not general reference.
So, do not describe "Direct Submission" in the title for literature in REFERENCE 2 or after.

Last Updated:July 1, 2014
Is there any reference for Feature/Qualifier? format search submission
I would like to know the date when the data was submitted. format search submission

In general, you can find accept date in JOURNAL line of REFERENCE 1 on DDBJ flat file.
Please note that some old data do not have the description of accept date.

Last Updated:July 1, 2014
Tell us conditions to release unpublished data. search submission
I like to hold my sequence data until publication of related paper, should l specify the hold date? submission update

See "Why is the hold-date required?". Please specify the date.
Though DDBJ does not restrict the date, we strongly recommend to specify the date within two years.
If not specified, the data will be published, immediately.

After data submission, you can change the hold date as needed.
Contact us from this form by selecting "Change the hold-date" in [Subject].

References
How to postpone the hold date?
Principle of “Hold-Until-Published” data release
Last Updated:June 16, 2017
I can not find sequence data that should be published. search update

There are some possibilities as followings.

1) In case of the meantime of data distribution:
The data may be on the process of data distribution. If you are unable to retrieve the data longer than a week, please send an inquiry including the accession number to ddbjupdt#64;ddbj.nig.ac.jp
2) The specified hold date of the data is in holidays of DDBJ:
We will release the data after holidays of DDBJ. See also DDBJ Calender.
3) In case of not yet confirmed the accession number is published on a paper or others:
Please let us know the paper or other media in which the accession number is described.
4) In case of the data submitted BEFORE January 1, 1998:
The sequence data be still unpublished after hold date.

In case of 3) or 4), we will check and support it.
Please contact us from contact form by selecting the item, "Updating Submitted Data" with accession numbers, or by mail to.

References
Principle of "Hold-Until-Published" data release
Can not find the sequence data, though the accession number cited on a paper.
Last Updated:June 16, 2017
When the data submitted with hold date is published, is there any announcement from DDBJ? submission update

If you set the hold date for your data, the data will be published according to Principle of “Hold-Until-Published” data release.
After setting to publish the data, the mail with "[DDBJ] Publicized your data" in its subject is sent to contact person.
So, Do not block E-mails from DDBJ.

If the information of contact person is old or invalid, we may be unable to acknowledge publication of your data or any other important announcement.
Contact us from this form to send request by selecting the subject, "Change the contact person, belonging, institution, etc..".

Last Updated:June 16, 2017
Why is the retracted data still available? search submission

For once published entries, we can restrict to use the data, if the conditions are right.
In case of the restriction, DDBJ will not include the data in its periodical release and remove from all services under DDBJ.
However, the data is permanently available on getentry queried with its accession number.
# The rule is not applied, when the data is published by any mistake of INSD.
This policy is written in the document prepared by International Advisory Committee of INSD on Overview of International Nucleotide Sequence Databases Policies as follows;


All database records submitted to the INSD will remain an entry accessible as part of the scientific record. Corrections of errors and update of the records by authors are welcome and erroneous records may be removed from the next database release, but all will remain permanently accessible by accession number.


In addition, there are a number of databases constructed by occasionally using data from INSD.
DDBJ can not support to delete data from such databases. If you are to delete the cited data on other databases, you have to contact managing staff of each database, directly.

Reference
INSDC Status Document
Last Updated:June 16, 2017
Can not find the sequence data, though the accession number cited on a paper. format search

DDBJ releases sequence data submitted with a hold date according to Principle of “Hold-Until-Published” data release.

Please confirm if the ID on the paper is Accession Number Assigned by INSD or not.

If accession numbers on the paper, please contact us from contact form by selecting the item, "Updating Submitted Data" with following items.

  • Accession numbers on the paper
  • Title of the paper
  • Authors
  • Journal name
  • Volume, pages, year
  • DOI, PubMed ID, URL
Last Updated:June 16, 2017
What is the search service that the latest data are available at the earliest period? getentry search

It is getentry.
"getentry" is a system for data retrieval by accession numbers, etc.
In general, the sequence data will be available on getentry from the day after processed to release.

Last Updated:June 25, 2014
Can not find appropriate feature key MSS NSSS submission

See Definition of Feature Key and Feature Table Definition.
When you can not find any accommodated feature, use misc_feature and enter information in value of /note qualifier.

For instance, since DDBJ is a database for nucleotide sequences, we do not prepare any specific item for amino acid sequence motifs.
However, you can describe such kind of information by using misc_feature with /note qualifier.

Last Updated:June 9, 2014
How are the data released from DDBJ published at EMBL-Bank, GenBank? format search

DDBJ is functioning as one of the international nucleotide sequence databases, including EMBL-Bank/EBI in Europe and GenBank/NCBI in the USA as the two other members.
When DDBJ releases the submitted data, EMBL-Bank and GenBank will load the data into their own services, respectively.
See Sequence Data Transition.
Note that the data are converted into EMBL-Bank or GenBank format.

Last Updated:June 8, 2015
How long are the temporal differences of data releases among DDBJ, EMBL-Bank and GenBank? search

In general, the data released from EMBL-Bank or GenBank are loaded into DDBJ services and published from DDBJ within their released date.
The data released from DDBJ are loaded into ENA/EBI and GenBank and published from them within a few days.
However, the data release processes at all three databases may be delayed, because of system maintenance, troubles on the network, or any other reasons. So, we can not specify the temporal differences among them.

Last Updated:June 8, 2015
How can I input amino acid sequence (/translation qualifier) for CDS feature? format MSS NSSS submission

The amino acid sequence for CDS feature will be automatically translated from nucleotide sequence according to location and other items, and reflected into /translation qualifier. So, in general, do not enter it.

References
[Nucleotide Sequence Submission System] How to confirm translated amino acid sequences (i.e. /translation qualifier) for CDS features?
The amino acid sequence in the value of /translation qualifier seems to be incorrect.
Last Updated:July 7, 2014
The amino acid sequence in the value of /translation qualifier seems to be incorrect. format search submission

The rule to translate nucleotide sequence into amino acid sequence is specified in accordance with agreements of International Nucleotide Sequence Database Collaboration.
The codon table using a CDS feature is specified in the value of /transl_table qualifier as a number of The Genetic Codes.

There are three points frequently misunderstood.

  • You should specify /organelle qualifier to assign correct genetic code for mitochondrion or chloroplast.
  • The initiation codon is M, Met, methyonine, not G or V.
        See Start codon and N-Formylmethionine
  • When an amino acid can be specified by two bases (i.e. degeneracy of codons), it will be outputted.

There are some exceptional cases, represented by RNA editing and so on.

Last Updated:July 3, 2014
Which should I use to submit to DDBJ, Nucleotide Sequence Submission System or Mass Submission System? MSS NSSS submission

Nucleotide Sequence Submission System is an interactive application to enter all of items required for your submission on step by step basis.
To use Mass Submission System (MSS), submitters have to make submission files by themselves. So, DDBJ will review and consult for submitters on the process of making files.
Some submitters use Nucleotide Sequence Submission System to submit a lot of sequences, while some submitter use MSS to submit a few sequences.
Based on above information, select either of them as needed.

Last Updated:July 3, 2014
How many data can I submit by using Mass Submission System? MSS submission

There is no limit of the number of entries to use Mass Submission System.
You can use it not only for many sequences but also for one long sequence with many features (i.e. complete genome with annotation).
See Mass Submission System

Last Updated:July 3, 2014
How can I check my sequence to exclude vector contamination? MSS NSSS submission
Last Updated:July 3, 2014
[Nucleotide Sequence Submission System] How to suspend and resume my submission? NSSS submission
Last Updated:July 3, 2014
[Nucleotide Sequence Submission System] How to entetr two or more features for a sequence? NSSS submission

At 6. template, a) select 'other' and click [Input annotation] or b) Click [Upload annotation file].
Then, you can describe two or more features for each sequence as follows.
In case of a), see 7.Annotation (when “other” was selected at template).
In case of b), see 7. Annotation: upload an annotation file.

Last Updated:July 4, 2014
[Nucleotide Sequence Submission System] How can I describe DEFINITION? NSSS submission

Since DEFINITION is constructed by DDBJ according to rules, there is no field to enter it.

Last Updated:July 4, 2014
[Nucleotide Sequence Submission System] Can not find input field for some qualifier NSSS submission

Click [Select Qualifier], check qualifiers in the dialog as needed and click [Save] button.
Then, you can find input fields for qualifiers on 7.Annotation.

Related to this issue, in case of selecting "other" on 6. template, you have to specify some features other than source. So, click [Add feature] and select some feature on the list.

Reference
7.Annotation (when “other” was selected at template)
Last Updated:July 4, 2014
[Nucleotide Sequence Submission System] How to fix error message: "First codon [***] is not a start codon." / "Final codon [***] is not a stop codon."? NSSS submission

These errors mean amino acid translation for CDS (protein coding sequence) feature is not appropriate in the 5' or 3' end, respectively.
When the CDS feature is not complete (i.e. partial) at 5' and/or 3' ends, its location is required to include flag for 'not complete'.
According to rules on Description of Location, partial sequences should be appropriately specified with flags for 5' end not complete, "<", and/or for 3' end not complete, ">" on its feature location.

For example: partial CDS feature in the range, 1..295
location condition
<1..295 [not start with initiation codon] and [stop with termination codon]
1.. >295 [start with initiation codon] and [not stop with termination codon]
<1.. >295 [not start with initiation codon] and [not stop with termination codon]
References
[Nucleotide Sequence Submission System] How to fix error message: “Stop codon ‘*’ is found in the range.”?
[Nucleotide Sequence Submission System] How to fix error message: "Value of [ codon_start ] is not 1, but [###..###] is 5' complete type."?
Offset of the frame at translation initiation by codon_start
Last Updated:July 7, 2014
[Nucleotide Sequence Submission System] How to fix error message: "To use [translation] qualifier, [exception] qualifier is required in the [CDS] feature." ? NSSS submission

This error message is outputted, because you select /translation for CDS feature by dialog of [Select Qualifier] button.
Generally, since /translation qualifier is automatically created according to items under CDS feature, do not enter any amino acid sequence.
So, you can fix the error by removing /translation qualifier.

For your information, /translation qualifier is required only in case describing with /exception qualifier.
Typically, /exception qualifier indicates "RNA editing" is occurred on mRNA. In that case, conceptual amino acid translation of genome sequence is different from protein product of real mRNA molecules.

References
Example of Submission: B09) RNA editing
How can I input amino acid sequence (/translation qualifier) for CDS feature?
[Nucleotide Sequence Submission System] How to confirm translated amino acid sequences (i.e. /translation qualifier) for CDS features?
The amino acid sequence in the value of /translation qualifier seems to be incorrect.
Last Updated:July 7, 2014
[Nucleotide Sequence Submission System] How to fix error message: "Invalid value [***] for [transl_table] qualifier."? NSSS submission

The error is occurred because you do not enter correct genetic code.
See 7.Annotation -- How to input an organism name.
To specify genetic code, enter digit in the input field.
The value will be automatically applied for /transl_table qualifier for CDS feature.

For your information, in case of a previously reported organism, the genetic code is automatically specified, by describing Scientific name (/organism qualifier) and /organelle qualifier. If your sequence is derived from an organelle other than nuclei, you have to specify /organelle qualifier to set the genetic code for mitochondrion, chloroplast or some, appropriately.

References
7.Annotation
7.Annotation – How to input an organism name
The Genetic Codes
About /transl_table qualifier
Last Updated:July 7, 2014
[Nucleotide Sequence Submission System] browser still waiting for response on the process of data input NSSS submission

At first, please save the URL of the page of Nucleotide Sequence Submission System.
Then, clear cache of the browser and reopen the saved URL.
It is likely to resolve the condition.

If not resolved, confirm if you use either of browsers Firefox or Chrome that we recommend to use.
If not, change to Firefox or Chrome and reopen the URL.

If you still have any problem, please contact us with followings from contact form by selecting the item, "DDBJ Nucleotide Sequence Submission System".

  • URL
  • Number of your sequences
  • OS: Windows, MacOSX, or Linux, and its version
  • Browser: software and its version
Last Updated:June 15, 2017
[Nucleotide Sequence Submission System] How to fix error message: "Value of [ codon_start ] is not 1, but [###..###] is 5' complete type."? NSSS submission

You may enter incorrect values for Location and/or /codon_start of CDS feature.
If the value of /codon_start is either of "2" or "3", the location of CDS feature should be 5' end not complete.

See Description of Location and modify the location with flag for "5' end not complete", for an example, from "1..300" to "<1..300".
When the CDS feature is started with an initiation codon, correct /codon_start with "1".

References:
Offset of the frame at translation initiation by codon_start
[Nucleotide Sequence Submission System] How to fix error message: "First codon [***] is not a start codon." / "Final codon [***] is not a stop codon."?
[Nucleotide Sequence Submission System] How to fix error message: "Stop codon ‘*’ is found in the range."?
Last Updated:July 7, 2014
[Nucleotide Sequence Submission System] Can I modify descriptions on a previous page? NSSS submission

You can modify your inputs on any pages before finishing your submission.
You can go back to each page by clicking either of 1.Contact person, 2.Hold date, 3.Submitter, 4.Reference, 5.Sequence, 6.Template or 7.Annotation in progress bar at upside of pages.


※Caution
After inputting feature annotation on 7.Annotation, if you do either of followings, feature annotation will be removed.
Last Updated:July 7, 2014
[Nucleotide Sequence Submission System] I can not upload my annotation file NSSS submission

Confirm following points.

  • You have to input the same entry names for both sequences and in annotation file.
  • The format of annotation file must be tab delimited text consisting with 5 columns.
  • The line feed code of annotation file must be in LF (unix format) or CR-LF (windows format).
  • You have to use correct names for feature and qualifier keys.

If you still have any problem, contact us from contact form by selecting the item, "Data Submission".

Last Updated:July 7, 2014
[Nucleotide Sequence Submission System] How to submit more than one sequence at once? NSSS submission

On 5.Sequence, input all of your sequences in multi-FASTA format. We will assign consequent accession numbers for your sequences.
Moving to 7.Annotation, you can enter feature annotation for each sequence at once.

Caution
※ All of following items must be unified for all sequences. You can not specify thenm for each sequence.
  • Contact person
  • Hold date
  • Submitter
  • Reference
※ You can select only one template on 6.Template for all sequences. You can not select a template for each sequence.
Last Updated:June 16, 2017
[Nucleotide Sequence Submission System] How to fix error message: "Stop codon ‘*’ is found in the range."? NSSS submission

In general, see How to describe CDS feature, when termination codon is found in the range.
You can also see Protein Coding Sequence; CDS feature to describe CDS feature.
Following items are case study for the error.

1. Did you correctly specify /codon_start qualifier to indicate reading frame of the CDS feature?
  Select 1, 2 or 3, appropriately.

References:
Offset of the frame at translation initiation by codon_start
[Nucleotide Sequence Submission System] How to fix error message: “First codon [***] is not a start codon.” / “Final codon [***] is not a stop codon.”?
[Nucleotide Sequence Submission System] How to fix error message: "Value of [ codon_start ] is not 1, but [###..###] is 5' complete type."?

2. Have you specify correct genetic code for /transl_table qualifier?
See followings and specify genetic code, appropriately.

References
The Genetic Codes
About /transl_table qualifier
[Nucleotide Sequence Submission System] How to fix error message: "Invalid value [***] for [transl_table] qualifier."?

3. Are there really some stop codons in the range of CDS feature because of frame shift, nonsense mutation, or some other reason?

3-1. In case of pseudogene
Click [Select Qualifier] button beside CDS and add /pseudogene qualifier. Then, you can specify /pseudogene qualifier with its controlled vocabularies.
See also b) considered pseudogene in detail.

3-2. In cases of unsure whether it is pseudogene or not, the reason of stop codon is uncertain, or on the process of diversity increasing related to acquired immunity, describe misc_feature, not CDS feature.
See a) Putative nonsense mutation, frameshift caused by uncertain reason, or on the process of diversity increasing related to acquired immunity for IgG etc. in detail.

In other cases. There are some possibilities to output this error because of ribosomal slippage, RNA editing, exceptional amino acid usage, transpon insertion and so on.

Last Updated:July 7, 2014
[Nucleotide Sequence Submission System] How to confirm translated amino acid sequences (i.e. /translation qualifier) for CDS features? NSSS submission

You can confirm amino acid sequences for CDS features as follows.

1. Download UME_win.zip (for Windows) or UME_mac.zip (for MacOSX) from Mass Submission System.
2. Download both annotation and sequence files at 8. Finish on DDBJ Nucleotide Sequence Submission System.
3. Run UME and load both annotation and sequence files. Then click [Execute] of transChecker.

The function to confirm amino acid sequences will be applied on DDBJ Nucleotide Sequence Submission System.

References
How can I input amino acid sequnce (/translation qualifier) for CDS feature?
The amino acid sequence in the value of /translation qualifier seems to be incorrect.
Last Updated:July 7, 2014
[Nucleotide Sequence Submission System] How to fix error message: "MGA:No entry name is found other than [ COMMON ], without feature [ DATATYPE/type=MGA ]."? NSSS submission

Though you have not yet enter either /organism or /mol_type on annotation table, you click [Confirm] button.
You must fill mandatory items of annotation (feature, location, qualifier) before clicking [Confirm] button.

On 7.Annotation, click [Select Qualifier] button beside 'source', and select qualifiers as needed. Then, click [Edit] button beside entry name and input /organism and others. Note that it is required to input at least one feature other than source.
See also 7.Annotation – How to input an organism name.

Last Updated:July 7, 2014
What is secondary accession number? format search submission update

INSD; International Nucleotide Sequence Database are composed of DDBJ, ENA and NCBI, and collect experimentally determined nucleotide sequence data.
A unique accession number issued by INSD for each submitted sequence data is defined as the INSD accession number.
On DDBJ flat file, the accession number is described in ACCESSION line.

If multiple entries are united to an entry, or if an entry is extensively modified after the submission, the responsible data banks may assign a new accession number to it. In these cases, the new accession number is called the primary accession number, and the old accession number(s) is/are called the secondary accession number(s).

In the flat file, the primary accession number is indicated first, then the secondary accession number(s) follows.

example
ACCESSION   AB999999 AB888888 AB777777
AB999999 -- primary accession number
AB888888 AB777777 -- secondary accession number

You can find the same updated entry with both the primary and the secondary accession numbers, in general.
However, if the old entry with secondary accession number has previously been open to the public, the old one is not removed. So, you can find the old record by getentry.

References
getentry HELP
INSDC Status Document: Replaced
Why is the retracted data still available?
Last Updated:July 7, 2014
Please see the DDBJ publication archive. PR
The services that exist for communicating information about DDBJ are as follows. Choose whichever resource is most appropriate for your purposes.
Last Updated:June 8, 2015
I would like to read old versions of DDBJ publications. PR
Last Updated:June 15, 2015
Regarding the phrase “after a scheduled DDBJ release”: When, specifically, does this phrase describe? ARSA getentry search
“Newly arrived DDBJ data (new data that have arrived after a scheduled DDBJ release)” are data made publicly available on the next day of the deadline or after for the most recent DDBJ release. The deadlines for the most recent releases are listed in the text of the release notes. For example, if the most recent release were Release 67, then the deadline would be 8/25/2006, as stated below; thus, in this case, “newly arrived DDBJ data” would be data made publicly available after 8/26/2006.
The present release contains the newest data prepared by the DNA Data Bank ofJapan (DDBJ), GenBank (*), and European Molecular Biology Laboratory/EuropeanBioinformatics Institute (EMBL/EBI) as of August 25, 2006. (This statement comes from the release notes for Rel. 67; the remainder of that discussion is omitted here.)
Last Updated:June 15, 2015
I did not obtain the search results that I was expecting. Did I make a mistake in conducting my search? ARSA BLAST getentry search
The DDBJ/EMBL/GenBank data banks share the sequences stored within each data bank, and in principle all three data banks should contain the same data. However, due to time delays in the inter-data-bank sharing of data released by individual data banks, as well as delays between the time at which data are entered into a data bank and the time at which the data are reflected in the corresponding search service, searches conducted using different services at the similar time on the same day may yield slightly different results. If you do not obtain the search results that you were expecting, time delays of this sort are the most likely culprit; however, for cases requiring a more detailed investigation, please contact the DDBJ via the “Other general questions” section of the contact portal. In this case, make sure to specify the following information:
  • The name of the search program and/or the URL that you used to conduct the search.
  • The search conditions that you used.
  • The date and time at which you conducted the search.
  • Accession number of the entry that should have been found.
  • URL of the search results.
  • Any other relevant information.
Also, please see the sections of this document corresponding to the following questions.
Last Updated:June 8, 2015
Does DDBJ offer data search and analysis services? analysis search
There are two ways of searching and analyzing data, as discussed below. Please select the option that is appropriate for your needs.
  • 1. Conducting searches and analyses using a network server such as an FTP or web server.
    You may access these networking tools via Search / Analysis.  
  • 2. Conducting searches and analyses by logging in to the supercomputer system at the National Institute of Genetics (NIG).
    (This requires a supercomputer user ID. You will need to sign up for a new user account on the NIG supercomputer system.)
Last Updated:June 15, 2015
What format should I use when including results obtained with DDBJ search and analysis software in a journal publication? search
The format differs from journal to journal; please ask the publisher. In your publications, please cite the original papers for the appropriate tools and state that you used DDBJ software for searching and analyzing gene sequence data.

Please see the DDBJ home page How to Use DDBJ Reference about the original papers and other related papers on the DDBJ search and analysis software.
Last Updated:April 13, 2016
Where can I find the original papers and other related papers on the DDBJ search and analysis software? BLAST ClustalW search
Please see the DDBJ home page How to Use DDBJ Reference.
Last Updated:April 13, 2016
Please distribute clones. analysis PR

The DDBJ is a database center of nucleotide sequences, so it does not distribute any clones.
Please contact the submitter of the clone sequence directly.

Last Updated:February 26, 2016
I would like to link to the DDBJ website or to include some Web screenshots on my website PR
Please see the DDBJ home page DDBJ website policy.
Last Updated:April 13, 2016
Is it possible to view search results at a later time? BLAST search
Search results may be accessed via the following URL, which contains a Request ID field.
http://blast.ddbj.nig.ac.jp/blast/r/Request ID
Request ID
Note that the Request ID will be displayed in the window that appears after transmitting the input. Make sure to note down this.
Input content post-transmission window
Search results display window
Reading period
Search results may be viewed up to 7 days after the execution of the search.
Last Updated:June 4, 2015
How do I interpret the search results? BLAST search
Search results are displayed in the following order.
  1. Precedence table of sequences with high homology scores
  2. Homologous sequences and their alignment
  3. Parameters and statistics
Note that the symbol “|” in the BLAST search results for nucleotide sequences indicates agreement between nucleotide sequences. For amino-acid sequences, matching amino acids will be displayed. The symbol “+” is used to indicate similarities between amino acids.

For further details, refer the original papers on BLAST.

BLAST Reference
Last Updated:June 4, 2015
A portion of the sequence that I entered was replaced with [N](X)! What happened? BLAST search
The sequence that you entered was filtered by the BLAST program. The filtering has the effect of replacing regions of your input sequence of low structural complexity with “N” (or “X” for amino-acid sequences). For details on filtering, see the section “Filtering” in the BLAST HELP. To disable filtering, select the OFF radio button in the “Filter” option in the lower portion of the Settings screen. Note with caution that setting this option to “OFF” may result in search times that are longer than normal.
Last Updated:June 3, 2015
Is it possible to specify BOOTSTRAP when performing analyses with ClustalW? analysis ClustalW
In ClustalW, BOOTSTRAP calculations are performed for all analyses.
Select [Download Tree File] at the end of the output file to download a .phb file.

Note that .phb files will not be produced if the following combinations of options are chosen for the [FORMAT] and [CLUSTERING] fields of the input form.
[FORAMT] [CLUSTERING]
PHYLIP NJ
NEXUS NJ
PHYLIP UPGMA
NEXUS UPGMA
Last Updated:June 8, 2015
What are the meanings of the three symbols “*”, “.”, and “:” in ClustalW? analysis ClustalW
These symbols are used to indicate amino acids aligned at the sites marked with the symbol.
“*” indicates perfect alignment.
“:” indicates a site belonging to group exhibiting strong similarity.
“.” indicates a site belonging to a group exhibiting weak similarity.
The criterion for distinguishing strong from weak similarity is as follows: Strong similarity corresponds to a PAM250 MATRIX score between amino acids of greater than 0.5, while weak similarity corresponds to a score of 0.5 or less. In the README excerpt, the lines horizontally adjacent to the phrases
     STA
     NEQK
     :
indicate the amino-acid groups in cases for which the corresponding symbol is present (These are written using single-character notation for amino acids).

The README file included with the ClustalW source package contains the following text.
---------------------------------------------------------------------------
12. The conservation line output in the clustal format alignment file has been changed.
Three characters are now used:
'*' indicates positions which have a single, fully conserved residue
':' indicates that one of the following 'strong' groups is fully conserved:-
       STA       NEQK
       NHQK
       NDEQ
       QHRK
       MILV
       MILF
       HY
       FYW
'.' indicates that one of the following 'weaker' groups is fully conserved:-
       CSA
       ATV
       SAG
       STNK
       STPA
       SGND
       SNDEQK
       NDEQHK
       NEQHRK
       FVLIM
       HFY
These are all the positively scoring groups that occur in the Gonnet Pam250
matrix. The strong and weak groups are defined as strong score >0.5 and weak
score =<0.5 respectively.
---------------------------------------------------------------------------
Last Updated:June 8, 2015
Is there a way to link directly to data (accession numbers) registered in the DDBJ? getentry search
Last Updated:June 8, 2015
I have a DRA account, but I can’t log in to Pipeline Pipeline
In order to use DDBJ Pipeline, you need a Pipeline-exclusive account, separate from your DRA account. We are sorry for the extra trouble, but please proceed to “create new account” from the log-in page, and acquire a new Pipeline account.
Last Updated:September 16, 2014
I have registered my new account, but I’m not receiving e-mails. Pipeline
Normally, you would receive an e-mail from ( pipeline_dev@ddbj.nig.ac.jp ) with your Login ID and Password within a few minutes. If it seems that you haven’t received this e-mail, please check the filter settings on your e-mail software. There is also the possibility that the registered e-mail address is not correct; once you have kindly confirmed this e-mail address, please try to register your account again.
Last Updated:September 16, 2014
My FTP connection is not good Pipeline
Case 1. DRA users

There are cases where DRA registered users cannot connect to FTP. When this occurs, if you log in to Pipeline, and change your password, FTP connection will be possible.

Case 2. FTP client is not responding

It is not possible for Pipeline to connect to FTP with an FTP client that is provided as standard on Windows and MAC.
An FTP over SSL server is used for Pipeline, and FTP log-in, as well as sending and receiving data, is encrypted; a client that can handle to this is necessary to use FTP.
For Windows, WinSCP, and for MAC, Cyberduck, can handle the above-mentioned connection.

WinSCP
http://winscp.net/
Cyberduck
http://cyberduck.ch/
  
Last Updated:September 16, 2014
On HTTP upload, the files are not displayed in a list Pipeline
For HTTP transmission, uploading takes time. In some cases transmission may be abandoned/disconnected before completion.

Furthermore, even once the files have been uploaded, sometimes the list is not updated; please re-load the page.
Last Updated:September 16, 2014
It’s taking a long time to run jobs, does this mean there is a problem? Pipeline
If you are running denovoAssembly, (Velvet in particular) you may need several days for processing completion.

In most cases the processing time will be stretched proportional to the data load to be processed, but depending on the setting method in Options, the quality of the original data etc., processing may not be completed at all. In this situation, it’s most likely that the job has been hung-up, and since left as it is, this would cause resources to be wastefully monopolized, we may force quit on our side.
Last Updated:September 16, 2014
My job generated an error Pipeline
( Pattern 1 )
If on the Status screen, the Status shows as “error” and the Start time as “not displayed”.
  • This error means that something has caused an inability to load he specified query files.
  • Please confirm that the specified query files are text files. (There are no particular specified filename extensions.)
  • Then confirm that there are no problems with the format of FASTA/FASTQ etc.
  • Please note that if there are blank lines (as final lines etc.) included, an error will be generated.
  • Please confirm that the filenames are in single-byte Roman letters (symbols). (Double-byte characters, in Japanese etc., are not handled)
  • Please check that there are no spaces in the filenames.
  • If you have selected Assembly→BLAT(mapping), and have not been able to obtain the Assembly results file, on BLAT(mapping) this status will occur.

FAQ_2_1e_1
( Pattern 2 )
If on the Status screen, the Status shows as “error” and the Start time as “displayed”.
  • Confirm that there are no problems with the format of FASTA/FASTQ etc. for the specified query files.
  • Please check the logical input value in Options etc.
  • From the Selecting Tools screen, you can refer to each Tool’s site, or Help. ※ Depending on the tool selected, there may be a maximum line length restriction.
  • On the Detail view screen, there are cases where the cause can be specified from the Command being run and the Log1 (standard output) and Log 2 (standard error); please check this.

( Pattern 3 )
If on the Status screen, the Status shows as “complete” and there is an error shown on the Detail view screen.
  • Please check the logical input value in Options etc.
  • From the Selecting Tools screen, you can refer to each Tool’s site, or Help. ※ Depending on the tool selected, there may be a maximum line length restriction.
  • On the Detail view screen, there are cases where the cause can be specified from the Command being run and the Log1 (standard output) and Log 2 (standard error); please check this.

FAQ_1_3e_1
If you cannot specify the cause, or if you would like to make a comment, please kindly contact support(pipeline_dev@ddbj.nig.ac.jp).
Last Updated:January 8, 2015
I can’t change the parameters (options) for the tools to be run. Pipeline
On the Tool Selection screen, there are links to the manual pages of each tool. Please read these, and then on the Setting for Assembly/Mapping screen, set the appropriate parameters in the blank box underneath Set optional parameters.
Last Updated:October 24, 2014
Can I delete the fields registered in User original sets? Pipeline
Currently we aren’t handling this, but we will raise it as a system improvement proposal.
Last Updated:October 24, 2014
Are the files generated in mapping only SAM files, and does generation of BAM files have to be executed separately with SAMTools? Pipeline
SAMTools is also programmed, so BAM files can be created too.
Last Updated:October 24, 2014
With the current functions of Pipeline, can SNP extraction not be carried out using varFilter? Pipeline
You can use mpileup for this.
Last Updated:October 27, 2014
Can I download SAMtools index files? Pipeline
We will look into handling this.
Last Updated:October 27, 2014
What happens if you select Uniq in Step 3 of Set optional parameters? Pipeline
From the lines showing the mapping results of the individual Reads within the SAM files, only lines with results where one area was mapped in a genome (including XT:A:U) are output (only BWA is handled). Please refer to the below. http://seqanswers.com/forums/showthread.php?t=5450
Last Updated:October 27, 2014
I don’t know the difference between SAMtools pileup and SAMtools mpileup. Pipeline
Mpileup is pileup with SNP calling added. Please refer to the below.
http://samtools.sourceforge.net/mpileup.shtml
Last Updated:October 27, 2014
Is out.sam SAM file generation for mapping information? Pipeline
It’s the generation results.
Last Updated:October 27, 2014
With the command samtools view -bS -o out.bam out.sam, will SAM--->BAM conversion occur? Pipeline
samtools view is a command which outputs, from the results mapped onto the reference sequence (genome), only the results from a specified domain. However, basically this is not permitted, so it will be all the reference sequence (genome) results.
http://samtools.sourceforge.net/samtools.shtml#3
Last Updated:October 27, 2014
With the command samtools sort out.bam out2, will there be BAM sorting, and an output format of out2.srt.bam? Pipeline
It will be downloaded as out2.bam.zip, and when you decompress this file, it will become out2.bam.
Last Updated:October 27, 2014
I don’t know what kind of files samtools view –hX out.bam>out.sam and merged SAM are. Pipeline
Merged.sam is likely to be the files within the framework of “Download merged pileup file” from the Detail view screen, but this is the results of sam per chromosome, combined into one.
out.samX
samtools view -hX
Usage: samtools view [options]|[region1 [...]]
Options: -h     print header for the SAM output
            -X     output FLAG in string (samtools-C specific) 

For sam and samX, the 2nd column inscription changes. Please refer to the below.
http://sourceforge.net/apps/mediawiki/samtools/index.php?title=SAM_FAQ#The_integer_FLAG_field_is_not_friendly_to_eyes
Merged SAM, if there is one chromosome, has the same contents as out.sam (but the Download files are compressed).
Last Updated:October 27, 2014
Is out2.bam a sorted BAM file? Pipeline
Yes
Last Updated:October 27, 2014
What are the browser that the DDBJ service supports? ARSA BLAST NSSS PR search
DDBJ recommend using the following OS and browsers to use our servises.
DDBJ HP
OS:Windows7 or later , Mac OSX10.9 or later
Browser:Firefox latest versions , Chrome latest versions
DDBJ Nucleotide Sequence Submission System
Browser:Firefox , Chrome
D-way Submission System
Browser:Firefox latest version, Chrome latest version
BLAST / ARSA
OS:Windows7 or later , Mac OSX10.6 or later
Browser:IE10.X , IE9.X , Firefox , Chrome , Safari5.X or later
However, the OS, browser environment recommended above is subject to change without prior notice.
Last Updated:November 24, 2016
The files that I uploaded using FTP are not reflected on the Web. Pipeline
Files uploaded to the FTP server are automatically transferred to a specific directory on the National Institute of Genetics (NIG) supercomputer after the upload is complete. Thus, it is normal for files to appear to have vanished after uploading.
Last Updated:April 28, 2015
The Delete button shown at the upper left of the [Job Status window] does not do anything. Also, I want to change the displayed file name. Pipeline
The function of the Delete key is currently disabled. This is because it is useful for development purposes to be able to refer to the execution records of jobs, even if the job failed. If you wish to delete those records nonetheless, we will do it for you; please contact us. (pipeline_dev@ddbj.nig.ac.jp) In general, it is not possible to change a submission accession that you have previously specified. If you wish to change the name of the file corresponding to a job, we will delete the job itself. Then you can use the procedure following file upload to specify a different name for Study Title.
Last Updated:April 28, 2015
I entered an accession number that is shown in the DRA Search display in the [Import Public DRA tab], but I got an error message saying that the number was not found. Pipeline
Within Pipeline, the displayed list of accession numbers is obtained from the list released by NCBI. This list may differ in some places from the list released by DDBJ. If you receive an error message saying that the item in question was not found, please contact us. We will take care of the problem. (pipeline_dev@ddbj.nig.ac.jp)
Last Updated:April 28, 2015
Data registered for DRA under the [Import Public DRA tab] cannot be imported. Pipeline
From the “Import Public DRA”, tab it is possible to select data that have already been released by DRA; however, at present, the system is not equipped with functionality to fetch unreleased data, even data previously registered within DRA, into Pipeline. We regret this inconvenience; please use FTP to upload the data to the Pipeline server, separately from DRA.
Last Updated:April 28, 2015
The Preprocessing step completed without any problems, but the resulting file has size 0 kb Pipeline
This is probably caused by an incorrect format specification for the Quality Score during execution of the Preprocessing step. Check the content of your query file and make sure that phred33 or phred64 is specified.
Last Updated:April 28, 2015
Are there any conventions in place for specifying file names or other parameters when performing the Preprocessing step? Pipeline
When uploading files, for paired-end, use the designations _1 and _2 at the end of the base file name (that is, just before the file extension) to distinguish the files.
Last Updated:April 28, 2015
I do not know how to fill out the blank input fields in the [Set Optional Parameters window]. Pipeline
Please read the manual for the tool that you have selected and configure all relevant options (for options that may be set to default values, leave the corresponding input fields blank). Entering any text other than option values will lead to run-time errors.
Last Updated:April 28, 2015
How do I send data currently stored on the DDBJ supercomputer to Pipeline? Similarly, how do I send data to the supercomputer after the Pipeline analysis? Pipeline
To upload data from the supercomputer to Pipeline, use the ftp command from the supercomputer to connect to the DDBJ Pipeline FTP server; this allows you to transfer data directly without going through your local computer. More specifically, the procedure is as follows. 1. After logging in to the gw supercomputer, use qlogin to move to one of the computational nodes. 2. Use the ftp command to connect to the server: $ ftp pdata.nig.ac.jp 3. When prompted, enter the DDBJ Pipeline user name and password. 4. Once you are connected, upload your files to the directory named query. After you have uploaded files, you may register them within Pipeline by following procedures similar to that used in the GUI. For the reverse process—copying result files to the supercomputer—at present, there is no way to do this. (However, it is possible to copy result files individually by specifying a destination location and assigning it write privileges.) As the question suggests, it would certainly be convenient if file transfers between the supercomputer and Pipeline could be carried out directly; this is a goal of future development efforts.
Last Updated:April 28, 2015
Our company would like to use Pipeline for commercial purposes. May we do so? If so, will the confidentiality of sequence information be guaranteed? Pipeline
There is nothing wrong with using DDBJ Pipeline for research and development purposes. However, please refrain from routinely incorporating the service into commercial endeavors, such as analyses that your company may be hired to perform on a contract basis. Regarding security, your data cannot be seen by other users; however, note with caution that other users will be able to see file names unless you rename them using the GUI settings. In addition, results are subject to volume restrictions and are deleted after 60 days. After this time period, you must repeat the analysis.
Last Updated:April 28, 2015
Is it possible to perform assemblies involving combinations of single-end and paired-end data from Illumina or Roche454? Pipeline
Tools supporting hybrid assembly, such as Velvet and ABySS, do exist; however, at present, Pipeline is not equipped with functionality to specify two types of reads, and thus hybrid assemblies may not be performed.
Last Updated:April 28, 2015
This question pertains to the BWA uniq option in the [Set Optional Parameters window]. What are the differences between the four possible choices for “Please choose uniq mode.”? Pipeline
  1. Do not remove any read. Do not take any steps to ensure uniqueness.
  2. Retain pairs when both reads mapped uniquely or one of reads mapped uniquely, and Discard other pairs. Retain a pair if either one or both of the two reads mapped uniquely. (The pair will be discarded if both reads yielded multiple hits.)
  3. Retain pairs when both reads mapped uniquely, and Discard other pairs. Retain a pair only if both reads mapped uniquely. (The pair will be discarded if either or both of the reads yielded multiple hits.)
  4. Retain uniquely mapped reads and discard multiply mapped reads. Retain only uniquely mapped reads irrespective of pairing. The optimal setting for this option depends on the circumstances, but option 3 is the most stringent, option 2 is the most lenient, and option 4 is somewhat intermediate between these two options.
Last Updated:April 28, 2015
Regarding the E value displayed in the BLAST analysis results: How is this value calculated? BLAST search
The E value is computed using the following formula, in which l denotes the length of the query string, n denotes the number of strings stored in the database, and S is a score that measures the homology between nucleic acids or between amino acids. Note that k and m are positive constants. E=k*l*n*exp^(-mS) If the BLAST output results computed using this formula are displayed in the form 1E-X, this means that the quantity has the value 10-X.
Last Updated:April 13, 2017
What rules govern the order in which BLAST search results are displayed? BLAST search
BLAST search results are displayed in descending order of homology score. There is no way to assign priorities to strings with identical scores, so there is no particular regularity to the order in which such strings are displayed.
Last Updated:June 1, 2015
The number of search results shown is too small! (I receive the message “No hit found.”) BLAST search
If the number of search results shown is fewer than the number specified for the options “Number of Search Results to Display” and “Number of Alignments to Display,” you may increase the number of displayed results by increasing the value of the “Expectation value” under the “Advanced settings” field. In such a case, try setting the expectation value to an extremely large number such as 10,000. Note that, if the string is too short (a sequence length of 10 or so), BLAST will frequently be unable to find matches.
Last Updated:June 1, 2015
Is there any restriction of sequence length to submit to DDBJ? MSS NSSS submission
Upper limit
If the sequence is really observed, there is no upper limitation of the sequence length to submit to DDBJ.
However, we can not accept any operationally joined sequence, for example, joining chromosomes. We accept each chromosome sequence, respectively.
For sequences greater than 500 kbases in its length, please submit by using Mass Submission System (MSS) instead of Nucleotide Sequence Submission System (NSSS).
Lower limit
For minimum length, DDBJ has no systematic restriction, however, when the sequence is less than 20 bp in its length, our system outputs "warning" to your data.
When the sequence has biological significance, even if it is a short sequence, DDBJ accepts the submission of it. However, we consider that more than fifteen bases would be required to describe something in general, such as full length of small RNA transcript, some of specific tag sequence and so on.
References
Is there any case to reject submission to DDBJ?
Acceptable data for DDBJ
Last Updated:February 26, 2016
Where to submit variation data, such as single nucleotide variations, structural variations, copy number variations (CNVs) and so on? category submission

At DDBJ, we do not provide any official services to accept SNV, CGH analysis, microarray, variation and so on.
We assume that you can submit your data at NCBI or EBI.
Please submit to some of followings. If you have any questions, please ask each database, directly.

NCBI: Gene Expression Omnibus (GEO), dbSNP, dbVar, ClinVar
EBI: ArrayExpress, European Variation Archive (EVA), Database of Genomic Variants archive (DGVa)

If your data are derived from human subjects, it may be required to submit your data to either of following controlled access databases.
The database of Genotypes and Phenotypes (dbGaP)
European Genome-phenome Archive (EGA)
Japanese Genotype-phenotype Archive (JGA)

References
After submission of SNP data to DDBJ, will it automatically reflect to dbSNP?
How to submit sequence data related to DNA polymorphism?
Last Updated:March 3, 2016
How do I get a FASTA format of TSA or WGS entries? getentry search

To get a FASTA format of TSA or WGS entries, please use "getentry", specifying the following values.

 ID : Specify the Accession Number.
 Output format : Select "total nt seq FASTA" for the result.
 Result : Select one from the following filetype for the output.

  • html
  • text
  • compress (gz)
 Limit : Set an upper limit number of the result.
               When you specify the Limit "0", there is no upper limit of the data acquisition.

For more information about each value, please see getenry HELP.

Please see the following video as well.

Last Updated:May 19, 2016
Sequence format acceptable for the submission (FASTA, multi-FASTA) MSS NSSS submission

For DDBJ nucleotide sequence submission system (NSSS), you must input nucleotide sequence(s) in FASTA format (for 1 sequence only) or in multi-FASTA format (for 2 or more sequences).
Related page: Format of the nucleotide sequences that you can paste or upload

You must insert the end flag (//) at the end of each sequence when you use MSS for the submission. Please see the page, "How to Make Sequence File".

See also Wikipedia, FASTA format

Last Updated:June 16, 2017
ページの先頭へ戻る