DDBJ Sequence Read Archive Handbook

DDBJ Sequence Read Archive (DRA)is an archive database for output data generated by next-generation sequencing machines including Roche 454 GS System®, Illumina Genome Analyzer®, Applied Biosystems SOLiD® System, and others. DRA is a member of the International Nucleotide Sequence Database Collaboration (INSDC)and archiving the data in a close collaboration with NCBI Sequence Read Archive (SRA)and EBI Sequence Read Archive (ERA).

Three INSDC partners regularly exchange data other than Analysis.

DRA accepts sequencing data from capillary sequencing platforms in the fastq format. Because DDBJ Trace Archive will be integrated to SRA, we basically do not accept sequencing chromatograms.

Metadata

Metadata objects

The metadata describes how the associated data have been obtained. The metadata are composed of 6 objects, Submission, BioProject, BioSample, Experiment, Run and Analysis. Each of these objects is defined by its XML schema and is related each other. Multiple Experiments can “point” to a single Sample, but not vice-versa.

Accession numbers with distinct prefixes are assigned to each object. Metadata and accession number system are common in DRA/ERA/SRA. The Experiment, Run and Analysis are the SRA objects, and the BioProject and BioSample are external database objects.

For details, please see the DRA XML schema

Submission

A container object only for grouping objects to be submitted.

BioProject

An overall description of a single research initiative; a project will typically relate to multiple samples and datasets.

BioSample

Description of biological source material; each physically unique specimen should be registered as a single BioSample with a unique set of attributes.

Experiment

A description of sample-specific sequencing library and sequencing methods. An Experiment references 1 BioProject and 1 BioSample. Multiple Experiments can “point” to a single Sample, but not vice-versa.

Run

Runs describe the files that belong to the previously created Experiments. They specify the data files for a specific sample to be processed by DRA. Note that all data files listed in a Run will be merged into a single SRA archive file, so files from different samples or replicates should not be grouped in the same Run. Paired-end data files, conversely, MUST be listed in a single run in order for the two files to be correctly processed as paired-end.

Analysis

Packages data associated with sequence read objects that are intended for downstream usage or that otherwise needs an archival home. Submit alignment data in bam file to Run. Please contact to DRA team to ask mirroring of analysis data.Analysis files are provided on the DDBJ ftp site and not indexed by the DRASearch.

Organization of metadata objects

Followings are examples of metadata. Submitters can organize metadata objects flexibly.

• Most simple case
• Comparative genome sequencing of three strains (paired-end)
• Technical and biological replicates (paired-end)
• Related sequencing data are reported in two publications

Most simple case

Comparative genome sequencing of three strains (paired-end)

Include paired-end read files in a Run.

Technical and biological replicates (paired-end)

Related FAQ: How many samples do I need for my DRA submission?

Related sequencing data are reported in two publications.

Items in each metadata object.

Required*
Conditionally required*

Submission

Center Name

Enter submitter’s organization.

Center Name*

A submitter’s center name. Center Name List. A center name abbreviation is required to submit data to DRA.

In the metadata creation tool, the center name is automatically filled with the account information.

The Center Name is an abbreviation operationally used by SRA and is not for indicating ownership of submission. Submitters listed in Submitter hold ownership of submission.

Lab Name*

Laboratory name within submitting institution. The Lab name is pre-entered with “Lab/Group”, “Department (2)”, “Department (1)”,”Organization” of D-way account. Text can be editted.

Hold Until

Specify how to release the data.

Hold Until*

Direct the DRA to release the record on or after the specified date.Submitter can set the hold date for a maximum of 2 years and can change the date before the record is released.

Immediate Release*

Direct the DRA to release the record immediately after submission is processed.

Submitter

The DRA contacts the listed address(es) regarding the submission by e-mail.Include contact information of PI and non-PI member(s) who actually submits data.The contact information is not made public. If you want to display the contact information, enter the information in the BioProject.

Name*

Name of submitter.

E-mail*

E-mail of submitter.

BioProject

BioProject ID*

Select a project registered to BioProject or submit a new project. For submission to BioProject, please refer to the BioProject Handbook.

BioSample

BioSample ID*

Select samples registered to BioSample or create and submit new samples. For submission to BioSample, please refer to BioSample Handbook.

Experiment

Alias

Name of the experiment designated by the archive. This alias is used to reference metadata objects without accession numbers.

BioSample Used*

Select the BioSample this experiment uses.

Title*

Short text that can be used to call out experiment records in searches or in displays. A title like “[Sequencing Instrument Model] [paired end] sequencing of [BioSample ID]” (for example, “Illumina HiSeq 2000 paired end sequencing of SAMD00025741”) is automatically constructed. To enter user-defined titles, download Experiment metadata into a tab-delimited text file, edit title values and upload it.

Library Name

The submitter’s name for this library.

Library Source*

The Library Source specifies the type of source material that is being sequenced.

Library Source	Description
GENOMIC	Genomic DNA (includes PCR products from genomic DNA).
TRANSCRIPTOMIC	Transcription products or non genomic DNA (EST, cDNA, RT-PCR, screened libraries).
METAGENOMIC	Mixed material from metagenome.
METATRANSCRIPTOMIC	Transcription products from community targets.
SYNTHETIC	Synthetic DNA.
VIRAL RNA	Viral RNA.
OTHER	Other, unspecified, or unknown library source material.

Library Selection*

Whether any method was used to select and/or enrich the material being sequenced.

Library Selection	Description
RANDOM	Random shearing only.
PCR	Source material was selected by designed primers.
RANDOM PCR	Source material was selected by randomly generated primers.
RT-PCR	Source material was selected by reverse transcription PCR.
HMPR	Hypo-methylated partial restriction digest.
MF	Methyl Filtrated.
repeat fractionation	Selection for less repetitive (and more gene rich) sequence through Cot filtration (CF) or other fractionation techniques based on DNA kinetics.
size fractionation	Physical selection of size appropriate targets.
MSLL	Methylation Spanning Linking Library.
cDNA	complementary DNA.
cDNA_randomPriming
cDNA_oligo_dT
PolyA	PolyA selection or enrichment for messenger RNA (mRNA); should replace cDNA enumeration.
Oligo-dT	enrichment of messenger RNA (mRNA) by hybridization to Oligo-dT.
Inverse rRNA	depletion of ribosomal RNA by oligo hybridization.
ChIP	Chromatin immunoprecipitation.
MNase	Micrococcal Nuclease (MNase) digestion.
DNAse	Deoxyribonuclease (DNase) digestion.
Hybrid Selection	Selection by hybridization in array or solution.
Reduced Representation	Reproducible genomic subsets, often generated by restriction fragment size selection, containing a manageable number of loci to facilitate re-sampling.
Restriction Digest	DNA fractionation using restriction enzymes.
5-methylcytidine antibody	Selection of methylated DNA fragments using an antibody raised against 5-methylcytosine or 5-methylcytidine (m5C)MBD2 protein methyl-CpG binding domain : Enrichment by methyl-CpG binding domain.
MBD2 protein methyl-CpG binding domain	MBD2 protein methyl-CpG binding domain.
CAGE	Cap-analysis gene expression.
RACE	Rapid Amplification of cDNA Ends.
MDA	multiple displacement amplification.
padlock probes capture method	Padlock Probes capture strategy to be used in conjuction with Bisulfite-Seq.
other	Other library enrichment, screening, or selection process.
unspecified	Library enrichment, screening, or selection is not specified.

Library Strategy*

Sequencing technique intended for this library.

Library Strategy	Description
WGS	Whole genome shotgun.
WGA	Whole genome amplification.
WXS	Random sequencing of exonic regions selected from the genome.
RNA-Seq	Random sequencing of whole transcriptome.
miRNA-Seq	Micro RNA and other small non-coding RNA sequencing.
ncRNA-Seq	Capture of other non-coding RNA types, including post-translation modification types such as snRNA (small nuclear RNA) or snoRNA (small nucleolar RNA), or expression regulation types such as siRNA (small interfering RNA) or piRNA/piwi/RNA (piwi-interacting RNA).
ssRNA-seq	strand-specific RNA sequencing
WCS	Whole chromosome (or other replicon) shotgun.
CLONE	Genomic clone based (hierarchical) sequencing.
POOLCLONE	Shotgun of pooled clones (usually BACs and Fosmids).
AMPLICON	Sequencing of overlapping or distinct PCR or RT-PCR products.
CLONEEND	Clone end (5’, 3’, or both) sequencing.
FINISHING	Sequencing intended to finish (close) gaps in existing coverage.
RAD-Seq	Restriction Site Associated DNA Sequence
ChIP-Seq	Direct sequencing of chromatin immunoprecipitates.
MNase-Seq	Direct sequencing following MNase digestion.
DNase-Hypersensitivity	Sequencing of hypersensitive sites, or segments of open chromatin that are more readily cleaved by DNaseI.
Bisulfite-Seq	Sequencing following treatment of DNA with bisulfite to convert cytosine residues to uracil depending on methylation status.
EST	Single pass sequencing of cDNA templates.
FL-cDNA	Full-length sequencing of cDNA templates.
CTS	Concatenated Tag Sequencing.
MRE-Seq	Methylation-Sensitive Restriction Enzyme Sequencing strategy.
MeDIP-Seq	Methylated DNA Immunoprecipitation Sequencing strategy.
MBD-Seq	Direct sequencing of methylated fractions sequencing strategy.
Tn-Seq	Gene fitness determination through transposon seeding.
FAIRE-seq	Formaldehyde Assisted Isolation of Regulatory Elements
SELEX	Systematic Evolution of Ligands by EXponential enrichment
NOMe-Seq	Nucleosome Occupancy and Methylome sequencing.
RIP-Seq	Direct sequencing of RNA immunoprecipitates (includes CLIP-Seq, HITS-CLIP and PAR-CLIP).
ChIA-PET	Direct sequencing of proximity-ligated chromatin immunoprecipitates.
Hi-C	Chromosome Conformation Capture technique where a biotin-labeled nucleotide is incorporated at the ligation junction, enabling selective purification of chimeric DNA ligation junctions followed by deep sequencing
ATAC-seq	Assay for Transposase-Accessible Chromatin (ATAC) strategy is used to study genome-wide chromatin accessibility. alternative method to DNase-seq that uses an engineered Tn5 transposase to cleave DNA and to integrate primer DNA sequences into the cleaved genomic DNA
Targeted-Capture
Tethered Chromatin Conformation Capture
Synthetic-Long-Read	binning and barcoding of large DNA fragments to facilitate assembly of the fragment
Other	Library strategy not listed.

Library Construction Protocol

Free form text describing the protocol by which the sequencing library was constructed. Please include protocols of DNA fragmentation, ligation and enrichment. If a library preparation kit is used, include the name and version (if any) of the kit (for example, Illumina Nextera DNA Library Preparation Kit).

Reference: Alnasir J, Shanahan HP. Investigation into the annotation of protocol sequencing steps in the sequence read archive. Gigascience. 2015 May 9;4:23. doi: 10.1186/s13742-015-0064-7. eCollection 2015. PMID: 25960871 (Open Access)

Instrument*

Select a sequencing instrument model.

Spot Type*

Select a layout of reads in sequencing data files.

Nominal Length*

Size of the insert for Paired reads.

Nominal Sdev

Standard deviation of insert size.

Spot Length*

The read length in submitted sequencing files. For mate pairs, this number includes mate pairs, but does not include gap lengths.

• When the spot length is constant, enter a constant value.
• For 454 platforms producing reads with variable length, enter a constant flow count.
• For fastq files with variable length, enter an average length.

Run

Alias

Name of the run designated by the archive. This alias is used to reference metadata objects without accession numbers.

Title*

Short text that can be used to call out run records in searches or in displays. A title like “[Sequencing Instrument Model] [paired end] sequencing of [BioSample ID]” (for example, “Illumina HiSeq 2000 paired end sequencing of SAMD00025741”) is automatically constructed. To enter user-defined titles, download Run metadata into a tab-delimited text file, edit title values and upload it.

Experiment Referenced*

Select the experiment this run belongs to.

Data files for Run

Select data files for a Run.

Run/Analysis

Specify whether a data file belongs to the Run or Analysis. In the web submission form, this field is un-editable and is automatically filled according to the selected Run or Analysis. To upload metadata in tsv file, this field needs to be specified manually.

File Name*

The name of a sequence data file. Uploaded filenames are automatically filled in.

Run/Analysis contains files*

Select a Run to which the data file belongs.

File Type*

The sequence data file format. For the fastq files, select ‘generic_fastq’ irrespective of read length. Do NOT select ‘fastq’.

File Type	Description
generic_fastq	fastq files
fastq	Select “generic_fastq” instead of “fastq”.
sff	454 Standard Flowgram Format file
hdf5	PacBio hdf5 Format file
bam	Binary SAM format for use by loaders that combine alignment and sequencing data
tab	A tab-delimited table maps “SN in SQ line of BAM header” and “reference fasta file”
reference_fasta	Reference sequence file in single fasta format used to construct SRA archive file format. Filename must end with “.fa”

MD5 Checksum*

MD5 checksum of a sequence data file. How to obtain the MD5 checksum values.

Analysis

Alias

Name of the analysis designated by the archive.This alias is used to reference metadata objects without accession numbers.

Title*

Title of the analyis object.

Description*

Describes the contents of the analysis.

Analysis Type*

Select an Analysis type. Submit alignment data to Run in bam format.

Analysis Type	Description
De Novo Assembly	A placement of sequences including trace, SRA, GI records into a multiple alignment from which a consensus is computed..
Sequence Annotation	Per sequence annotation of named attributes and values. Example: Processed sequencing data for submission to dbEST without assembly. Reads have already been submitted to one of the sequence read archives in raw form. The fasta data submitted under this analysis object result from the following treatments, which may serve to filter reads from the raw dataset: - sequencing adapter removal - low quality trimming - poly-A tail removal - strand orientation - contaminant removal.
Abundance Measurement	Identify the tools and processing steps used to produce the abundance measurements (coverage tracks).

Data files for Analysis

Select data files for an Analysis.

Run/Analysis

Specify whether a data file belongs to the Run or Analysis. In the web submission form, this field is un-editable and is automatically filled according to the selected Run or Analysis. To upload metadata in tsv file, this field needs to be specified manually.

File Name*

The name of an analysis file.

Run/Analysis contains files*

Select an Analysis to which the data file belongs.

File Type*

The analysis data file format.

File Type	Description
bam	Binary form of the Sequence alignment/map format for read placements, from the SAM tools project. See http://sourceforge.net/projects/samtools/.
tab	A tab delimited text file that can be viewed as a spreadsheet. The first line should contain column headers..
ace	Multiple alignment file output from the phred assembler and similar programs. See http://www.phrap.org/consed/distributions/README.16.0.txt for a description of the ACE file format..
fasta	Sequence data format indicating sequence base calls.The format is simple: a header line initiated with the > character, data lines following with base calls..
wig	The wiggle (WIG) format allows display of continuous-valued data in track format.This display type is useful for GC percent, probability scores, and transcriptome data. See http://genome.ucsc.edu/goldenPath/help/wiggle.html for a description of the Wiggle Track format..
bed	BED format provides a flexible way to define the data lines that are displayed in an annotation track. See http://genome.ucsc.edu/FAQ/FAQformat#format1 for a description of the BED format..
vcf	Variant Call Format. See http://www.1000genomes.org/wiki/analysis/variant%20call%20format/vcf-variant-call-format-version-41 for a description of the VCF format.
maf	Mutation Annotation Format
gff	General Feature Format
csv
tsv

MD5 Checksum*

MD5 checksum of a run data file. How to obtain the MD5 checksum values.

Run data files

Formats of sequencing data files

The DRA metadata submission tool cannot describe technical reads (adapter, primer and barcode sequences). “To submit raw data contain technical reads” and “To use metadata elements in DRA XML schema the but not in the submission tool”, submitters need to create metadata in XML files(XML examples).

Generic formats

Platform specific formats

BAM file

Binary Alignment/Map files (BAM) represent one of the preferred DRA submission formats. BAM is a compressed version of the Sequence Alignment/Map (SAM) format (see SAMv1.pdf). BAM files can be decompressed to a human-readable text format (SAM) using SAM/BAM-specific utilities (e.g. samtools) and can contain unaligned sequences as well. DRA recommends to submit BAM including unaligned reads as primary data into Run.

SAM is a tab-delimited format including both the raw read data and information about the alignment of that read to a known reference sequence(s). There are two main sections in a SAM file, the header and the alignment (sequence read) sections, each of which are described below. Note that this documentation will focus on a description of the SAM format with respect to submission of BAM files to the DRA (i.e. DRA doe not accept SAM files for submission). A more comprehensive discussion of the format specifications can be found at the samtools website.

SAM Header Example:

@HD    VN:1.4    SO:coordinate
@SQ    SN:CHROMOSOME_I    LN:15072423
UR:ftp://ftp.ncbi.nlm.nih.gov/genbank/genomes/Eukaryotes/invertebrates/Caenorhabditis_elegans/
WBcel215/Primary_Assembly/assembled_chromosomes/FASTA/chrI.fa.gz    AS:ce10    
SP:Caenorhabditis elegans
 
@SQ    SN:CHROMOSOME_II    LN:15279345    
UR:ftp://ftp.ncbi.nlm.nih.gov/genbank/genomes/Eukaryotes/invertebrates/Caenorhabditis_elegans/
WBcel215/Primary_Assembly/assembled_chromosomes/FASTA/chrII.fa.gz     AS:ce10    
SP:Caenorhabditis elegans  
 
@RG    ID:1    PL:ILLUMINA    LB:C_ele_05    DS:WGS of C elegans    PG:BamIndexDecoder
@PG    ID:bwa    PN:bwa    VN:0.5.10-tpx

SAM Alignment Example:

3658435    145    CHROMOSOME_I    1    0    100M    CHROMOSOME_II    2716898    0    
GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT
AAGCCT    
@CCC?:CCCCC@CCCEC>AFDFDBEGHEAHCIGIHHGIGEGJGGIIIHFHIHGF@HGGIGJJJJJIJJJJJJJJJJJJJJJJJJJJJHHHHHFF
FFFCCC    RG:Z:1    NH:i:1    NM:i:0
    
5482659    65    CHROMOSOME_I    1    0    100M    CHROMOSOME_II    11954696    0    
GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT
AAGCCT    
CCCFFFFFHHGHGJJGIJHIJIJJJJJIJJJJJIJJGIJJJJJIIJIIJFJJJJJFIJJJJIIIIGIIJHHHHDEEFFFEEEEEDDDDCDCCCA
AA?CC:    RG:Z:1    NH:i:1    NM:i:0

BAM file processing

The header and alignment section are internally consistent: each aligned read has an RNAME (reference sequence name, 3rd field) that matches an SN tag value from the header (e.g., CHROMOSOME_I), and, if provided,the alignment read group optional field (RG:Z:) is consistent with the read group ID in the header (1). It is also important to ensure that the FLAG fields (2nd field in each line) are correctly set for the data. The SRA pipeline will attempt to resolve incorrect FLAG values, but sufficiently incorrect values can lead to processing errors. The SRA does not archive optional and non-standard tags/field values contained in the alignment section. However, the entire header section of the bam file is retained. Additionally, although the SAM format allows for an equal sign (=) in the sequence field to represent a match to the reference sequence or only an asterisk (*) in both the sequence and quality fields, the DRA processing software does not recognize either of these formats.

Please note that unexpected notations used to indicated paired reads can lead to failure to recognize the pairs and an improper SRA archive (i.e. paired reads are treated like fragments). For example, using :0 and :1 at the end of the read names is atypical and is currently not recognized as an indication of read 1 and 2 in a pair. It would be better to exclude these notations and provide the two reads with the same names. Expected notations for particular platforms will work. For example, Illumina reads with /1 or /2 appended is an expected notation. Further, neglecting to set the proper bits for paired reads in the SAM/BAM flags (e.g. multi-segment template 1-bit, first segment 64-bit, and last segment 128-bit) or splitting paired reads into separate bam files can result in an improper SRA archive or failure to generate the SRA archive.

In the case of submitting alignment data, you need to submit “BAM”, “INSDC, refseq accession number OR reference multi-fasta” and “SN-reference mapping table”. Submit one bam file per Run.

When submitting bam file into Analysis instead of Run, the mapping table is unnecessary. However, please consider to submit bam including unaligned reads as primary data into Run.

1. BAM file submission

   The alignment data can be submitted in the BAM format. The bam files should be readable by SAMtools and picard. The BAM files are nearly optimal in terms of compression and should be submitted uncompressed.

2. Specify reference by INSDC/RefSeq accession number {#Specify_reference_by_INSDC/RefSeq_accession_number}

   If references are found in list, references can be specified by their accession.version number (for example, NC_000001.11). Version numberis necessary. Accession numbers for references can be searched in NCBI Assembly.

3. Specify reference by supplying multi-fasta

   If references are not found in the list, submit a reference file in multi-fasta format. Select “reference_fasta” in the Run file type. The reference name in the bam header and reference sequence are linked by the name in bam header and fasta defline via the mapping table. If sequence length is different between @SQ-LN and multi-fasta, a warning is raised.

4. Specify reference by both INSDC/RefSeq accession number and multi-fasta {#Specify_reference_by_both_INSDC/RefSeq_accession_number_and_multi-fasta}

   If a part of references are found in list, these references can be specified by their accession.version number (for example, NC_000001.11). The rest of references needs to be supplied by uploading a multi-fasta file. In the SN-reference mapping table, list accession.version numbers and sequence names of multi-fasta deflines.

5. SN-reference mapping table

   A tab delimited text file describing mapping between “SN in SQ line in BAM header” and “accession OR sequence name in fasta file”. Select “tab” in the Run file type

BAM header

@HD VN:1.0 GO:none SO:coordinate
@SQ SN:chr1 LN:249698942
@SQ SN:chr2 LN:242508799
@SQ SN:chr3 LN:198450956
...

SN-fasta mapping table. In the example, the reference named ref1 in multi-fasta file corresponds to the SN:chr1.

chr1 ref1
chr2 ref2
chr3 ref3
...

Reference multi-fasta.

>ref1
CGGTGGGGGTGGTGTTAGTACCCCATCTTGTAGGTCTGAAACACAAAGTGTGGGGTGTCT
...
>ref2
TCCACCAACGTTAGAAGGCCTTGGCCCCCAGAGAGCCAATTTCACAATCCAGAAGTCCCC
...
>ref3
GTGTGTGACCAGGGAGGTCCCCGGCCCAGCTCCCATCCCAGAACCCAGCTCACCTACCTT
...

SN-fasta mapping table. In the example, the reference “NC_000001.11” corresponds to the SN:chr1.

chr1 NC_000001.11
chr2 NC_000002.12
chr3 NC_000003.12
...

fastq

Run filetype needs to be specified depending on whether read length is constant or not.

• For the fastq files with constact read length, select ‘fastq’ in the file typeof Run. Paired reads should appear in the same order in the paired files.
• For the fastq files, select ‘generic_fastq’ in the file type of Run irrespective of read length.

Format of fastq, for details, please see NCBI website.

• Quality values must be in Phred scale. By default, 33 (!) is used for Phred quality offset. In the case of 64 (@), update the ascii_offset of Run XMLto ‘ascii_offset=”@”’.
• In the DRA metadata submission web interface, technical reads (adapters, linkers, barcodes) cannot be described. When submitting fastq including technical reads, please describe technical reads in the Experiment XML according to Formats of sequencing data files (XML examples). The Experiment XML submission is not necessary for fastq without technical reads.
• Paired reads must split and submitted using two Fastq files. The read names must have a suffix identifying the first and second read from the pair, for example ‘/1’ and ‘/2’.
• The first line for each read must start with ‘@’.
• The base calls and quality scores must be separated by a line starting with ‘+’.
• The Fastq files must be compressed using gzip or bzip2.

454

The DRA accepts sequencing run data from the 454 platform in the sff and fastq/bam format. These files should reflect the sequencing run setup. If a sff file contains data derived from more than one sample, please break up resulting fastq file into files contain data from only one sample.

The read names found in the .sfffile are meaningful and reflect the addressing scheme for the picotitre plate as well as a globally unique run id. Please do not rewrite this name in the sff as such addressing information will be lost. The sff file format is nearly optimal in terms of footprint, so there is little to be gained by further compressing them. Therefore, please provide .sfffiles uncompressed.

Illumina Genome Analyzer

Illumina pipeline v1.4 and later

DRA does not accept qseq files. Please convert qseq to fastq/bam.

SOLiD

SOLiD Native Format

DRA does not accept SOLiD native files. Please convert the native files to fastq/bam.

Ion Torrent

Submit Ion Torrent data in the sff or fastq/bam format.

Helicos Heliscope

Submit Helicos data in the sms（helicos_native) or fastq/bam format created with the fixed-quality value, “14”.

Complete Genomics

Submit Complete Genomics data in the fastq/bam format.

Pacific Biosciences

HDF5

Pacific Biosciences uses HDF5, a container file with a directory-like structure, to store raw data. The DRA accepts both bas.h5 and bax.h5 file submissions. Note that submission of data from the RS II instrument requires one Run consists of one *.bas.h5 file and three *.bax.h5 files. Do not rename files.

bam

We support the submission of the following types of PacBio bam files. Include 1 bam file per Run. For an unaligned bam file, reference and mapping table are not necessary.

• *.subreads.bam
• *.ccs.bam
• *.reads.bam

fastq

The DRA also accepts Pacific Biosciences data in the fastq format. Select the “generic_fastq” for the Run filetype.

Oxford Nanopore

Submit Oxford Nanopore data in the fastq/bam format.

Capillary sequencing platform

Submit capillary sequencing data in the fastq/bam format.

Analysis data files

PacBio Base Modification Files

PacBiosequence data also permits the analysis of methylated bases within the sequence, which can be extremely helpful to the scientific community. For example, the precise positions of those modified bases can be used to determine the specificity of the DNA methyltransferases that produced them. The PacBio analysis suite contains an analysis workflow (RS_Modification_and_Motif_Analysis) to extract these sequences and produce several files:

• motif_summary.csv
• modifications.csv
• modifications.gff
• motifs.gff

It would be beneficial to the scientific community if you were able to perform this analysis and submit at least the motif_summary.csv file for prokaryotes via as a DRA Analysis object. Please submit these files as data files of the Analysis with Sequence Annotation typein addition to sequencing reads in Run. For assistance, contact us.

NCBI guidelines of PacBio Base Modification Files

BioNano Whole Genome Map Files

BioNano mapping technology produces whole genome maps. These maps can be used in a variety of genomic analyses, including de novo assembly, structural variant detection and assembly curation. For example, BioNano physical maps can be integrated with de novo genome assemblies produced from next-generation technologies to produce high quality hybrid assemblies with increased continuity and completeness, especially in regions of genomic complexity. Files produced as part of the BioNano mapping and or hybrid assembly process include:

• CMAP
  • The BioNano Genomics Irys .cmap file is a raw data view of a molecule set or assembly reporting a label site position within a genome map identified during a run. The Irys .cmap file reports the start and end coordinates and the locations of the labels on a map using a tab-delimited text based file.
• COORD
  • The purpose of the .coord file is to relate the coordinates of scaffolds in a hybrid assembly to the corresponding AGP submission. The .coord file maps positions from the hybrid cmap, which may not begin or end with sequence gaps. The scaffolds are trimmed up to the leftmost label of leftmost sequence and the rightmost label of the rightmost sequence.
• XMAP
  • The BioNano Genomics Irys .xmap file is a cross-comparison between two maps. The Irys .xmap file reports the comparison derived from the alignment between an anchor .cmap file and a query .cmap file. The data line displays the map start and end coordinates and the locations of the labels on the map using a tab-delimited text based file.
• SMAP
  • The BioNano Genomics Irys .smap file is a description of structural variations (SV) detected between two genome maps. The Irys .smap file reports the structural variants discovered during an alignment between an anchor .cmap file and a query .cmap file. The data line displays the start and end coordinates and the locations of the SV on the map using a tab-delimited, text-based file.
• BNX
  • The BioNano Genomics Irys .bnx file is a raw data view of molecule and label information and quality scores per channel identified during a run.

For the latest file specifications, please see the BioNano GitHub site.

If you are using BioNano data as part of your assembly generation pipeline, it would be extremely useful to the scientific community if you could submit a package comprised minimally of the molecule .bnx file and the resulting de novo assembly file EXP_REFINEFINAL1.cmap and COORD files as a DRA Analysis. We will add an analysis type and filetypes for the BioNano Genome Map files. In the meantime, please submit the BioNano files as the analysis type “De Novo Assembly” and the filetype “tsv” (Example, DRZ011299, DRZ011300).

Submission to the DRA

Metadata and sequence data are required for submission to the DRA.

Please submit the assembled sequence data to the DDBJ. The DDBJ Mass Submission System (MSS)accepts the genomic or abundant sequence data generated by massively parallel sequencing platforms.

Data submission to DRA

1. Obtain a submission account

• Create a D-way submission account
• To enable DRA submission, register a public key and a center name to the account

2. Create a DRA submission and upload data files

• Create a new DRA submission ( Add DRA submission functionality to your account)
  All sequencing data in single submission will be released at the same time.
• Upload data files by scp before submitting BioProject, BioSample, Experiment and Run

3. Submit project and sample information

BioProject

• A description of the reseach effort
• “Why” you sequenced your samples

BioSample

• A description of biologically or physically unique specimens
• “What” you sequenced

metadata can be submitted as a tab-delimited text file

4. Submit Experiment and Run

DRA Experiment

• A description of a sample-specific sequencing library
• “How” you performed the sequencing
• Multiple Experiments “point” to a single Sample, but not vice-versa.

DRA Run

• Validate data files after submitting Experiment and Run
• All files linked to a Run are “merged” into a single SRA file format

5. Validate sequencing data files

• Start to convert sequencing data files into a SRA file for archiving.
• Submission passed validation step will be reviewed and accessioned.

How to submit data to the DRA

Submission to BioProject/BioSample/DRA (6 min 50 sec、created:2015)

Submission Account

At the DNA Data Bank of Japan (DDBJ) center, BioProject, BioSample, and DRAsubmissions are managed in user’s account.

According to the Submission Account Handbook, obtain a submission account and enable DRA submission in the account.

Organize data

Examples of metadata object organization is here. In single submission, only one BioProject can be registered. Multiple BioSample, Experiment, Run objects can be registered. To easily organize your data into a submission, please first consider number of BioSamples.

In this chapter, submission steps are explained by submitting a example submission “paired-end genome sequencing of three bacterial strains”.

Create a new submission

Login the D-way (https://ddbj.nig.ac.jp/D-way/) and the top page is displayed. Move to the DRA submission site from the “DRA” menu at the top.

Create a new submission by clicking the [New submission]. At this time, in the DRA file server (ftp-private.ddbj.nig.ac.jp), the corresponding subdirectory is created under the submitter’s home directory. Upload sequence data files to this subdirectory.

List of submission status is as follows. The DRA team reviews submission whose status is in “submission_validated” or “data_error”.

List of submission status

Upload sequence data

Sequence data files need to be uploaded before creating metadata. Do NOT create any sub-directories. To create metadata first, upload some files.

$ scp -i private-key-for-auth <Your Files> <D-way Login ID>@ftp-private.ddbj.nig.ac.jp:~/<DRA Submission ID>

Create metadata by using the tool

Move to the submission detail page by clicking the submission ID.

Click the [Enter / Update metadata] button to run the DRA metadata creation tool.

When no file is uploaded to the submission directory, following message is displayed. To submit metadata, please upload data files.

To submit metadata first, upload some files (for example, empty text file).

The metadata are composed of the Submission, BioProject, BioSample, Experiment, Run, Analysis (optional) objects. In the metadata creation tool, enter content from left to right tabs.

Required items are marked with *.

The entered content is checked when submitters click the [Save] button or before moving to the other tab. When error messages are displayed, please revise the content.

Submission

Set the hold date within two years. Include principal investigator(s) and submitter(s) who actually submit data in the Submitter. The DRA dose not disclose the submitter information to public.

Study

Submit a new project by clicking [New submission], or select a project registered in the account.

Only one project can be submitted. To reference a project obtained in the other account, please contact DRA team.

To submit a BioProject, enter content from left to right tabs. The second panel is for BioProject submission. Submitter information is copied with that of DRA submission.

For BioProject metadata, please see the BioProject Handbook.

To submit data corresponding to personal identification code to DRA/GEA/DDBJ, your data submission application needs to be approved by NBDC before the submission. If your application was approved, write the NBDC application ID (for example, J-DS000001-001) in “Private comments to DDBJ staff” of BioProject.

To submit genome assemblies to DDBJ, a unique Locus tag prefix is necessary.

Locus tag prefix generation box will appear when [Project data type=”Genome Sequencing” or “Metagenome”] AND [Capture=”Whole”] AND [Objective=”Sequence” or “Annotation” or “Assembly”]. Registration of a unique locus tag prefix is required for studies that result in genome assemblies.

The locus_tag prefix can contain only alpha-numeric characters and it must be at least 3-12 characters long. It should start with a letter, but numerals can be in the 2nd position or later in the string. (ex. A1C). There should be no symbols, such as -* in the prefix. The locus_tag prefix is to be separated from the tag value by an underscore ‘’, eg A1C_00001.

Please leave the prefix box empty, when a prefix is not necessary for WGS only submission.

Prefix is managed by NCBI. When a project is submitted, our system tries to reserve prefix to NCBI. When the prefix has already been reserved, an error message will be displayed. Please enter a different prefix and submit again.

Check the content in “OVERVIEW” and submit a project by clicking [Submit BioProject].

After submitting a project, submitted one is selected in Study.

Sample

Submit new samples by clicking [New submission], or select samples submitted in the account.

To select a range of samples, first check a checkbox and click next box with pressing the “Shift”. Filter samples by entering text in the upper box, and click [Select filtered BioSamples] to select all filtered samples.

To reference samples obtained in the other account, please contact us.

To submit a BioSample, enter content from left to right tabs. The second panel is for BioSample submission. Submitter information is copied with that of DRA submission.

Biological and technical replicates are represented by separate BioSamples. Regarding necessary number of sample for sequence submission, please see the “FAQ: How many samples do I need for my DRA submission?”

For BioSample metadata, please see the BioSample Handbook.

Select a sample type in the “SAMPLE TYPE”. For genome samples, minimum sample attributes are defined by MIxS.

For the Sample type, please see the BioSample Handbook.

Download a template text file according to the selected sample type to enter sample attributes.

A main sample submission step is to describe samples by required, optional and user-defined attributes.

BioSample attribute list. User-defined attributes can be added at rightmost column. Please see the “Human Sample” page about human samples.

BioSample submission file examples

A text file is separated by tab and can be opened and editted in spreadsheet editor (e.g. Excel®). Attribute names are in a header line. Attributes with “*” are required.

From second lines, enter one sample per line. Enter PSUB submission id in bioproject_id for project without PRJD accession numbers. For attributes without measured values, enter “missing” or “not applicable”.

Upload the BioSample submission file by selecting the file and clicking the Continue button. The validator checks the uploaded file and feedbacks error and warning messages. Submitter can not submit the BioSample until all errors are resolved.

For the validation rules and messages, please see Validation rules page.

Check content in the last “OVERVIEW” and submit samples. In the “ATTRIBUTES” area, the submitted sample attribute file can be downloaded.

After submitting BioSamples, submitted BioSamples are selected in the “Sample” tab.

Experiment

Experiment and Run as same as selected BioSamples are automatically created. Each BioSample,Experiment and Run are referenced. The Experiment and Run are automatically generated when the Experiment tab is initially displayed.

In this example, 3 Experiments are created and each Experiment reference unique BioSample.

Add an Experiment by clicking the [Add new Experiment(s)] and delete an Experiment by clicking the [Delete]. Experiment referenced by Run cannot be deleted.

Experiments can be submitted in a tab-delimited text file. First save and fix Aliases (e.g., test07-0040_Experiment_0001 - 0003) by clicking the [Save]. Alias is used as a name until accession numbers are issued.

Download content into a tab-delimited text file by clicking the [Download TSV file].

Metadata can be editted in spreadsheet software (e.g. Excel®).

If “Title” values are empty, titles are automatically constructed as “[Sequencing Instrument Model] [paired end] sequencing of [BioSample ID]” (e.g., “Illumina HiSeq 2000 paired end sequencing of SAMD00025741”). Submitters can provide user-defined text in the “Title”.

Reference samples in “BioSample Used” by “SSUB BioSample Submission ID”

“Sample name” (example, SSUB003746 : Genome bacteria strain A). Spaces around “:” are ignored.

Save editted content in a tab-delimited text file and select and upload it by clicking the [Upload TSV file].

Run

Experiment and Run as same as selected BioSamples are automatically created. Each Run references unique Experiment.

In this example, three Runs are created and each Run references unique Experiment.

Add Run by clicking the [Add another Run(s)] and delete Run by clicking the [Delete]. Run linked to files cannot be deleted.

After fixing aliases by clicking the [Save], run content can be downloaded into a tab-delimited text file. To distinguish the data files for Run, enter “Run” in the leftmost “Run/Analysis” column.

Click the [Select data files for Run] and link uploaded files to Run.

All files uploaded to the submission directory are shown. Associate a file to a Run by selecting a Run alias in “Run/Analysis contains files”.

Enter File type and MD5 Checksum for files. File attributes can be entered by uploading a tab-delimited text file.

When an Analysis (optional) is unnecessary, submit metadata by clicking the [Submit/Update DRA metadata].

After submitting DRA metadata, start validation of data files. Click the link “Validate uploaded data files to finish this submission”.

Analysis (optional)

Create Analysis as many as required, enter content of each Analysis. Unnecessary Analysis can be deleted by clicking the [Delete].

Click the [Select data files for Analysis] and link files to Analysis.

Enter file attributes and associate them with Analysis. When submitting the file attributes by uploading the tab-delimited text file, to distinguish the data files for Analysis, enter “Analysis” in the leftmost “Run/Analysis” column.

Submit DRA metadata by clicking the [Submit/Update DRA metadata] and proceed to data validation process. Only md5 of analysis files are checked during validation.

Validation of data files

Submitted data files are converted to the SRA files for archiving. During this conversion process, MD5 value, file format and integrity between files and metadata are validated.

In the “Data Files”, filenames in the Run and Analysis, MD5 values in the Run and Analysis and those of uploaded files, are displayed.

Click the [Validate data files] and validate uploaded data files.

The files are validated in the following order.

FAQ: How to deal with validation errors?

MD5 Check

Consistency between the MD5 values in the metadata and of uploaded files are checked. Inconsistency in the MD5 values cause errors. When MD5 errors occur, revise metadata and re-upload files.

Data Check

Submitted data files are converted to the SRA files for archiving. During this conversion process, MD5 value, file format and integrity between files and metadata are validated. When errors occur, revise metadata and re-upload files. Validation of large files takes time.

If no errors occur, submission status become “submission_validated”, and validated files are moved to separate directory.

The DRA staff review submissions with status “submission_validated”. Please do not touch submissions until the DRA staff contact submitters.

Revise a submission with “data_error”

Any errors in the validation process make the submission status to “data_error”. Revise metadata and/or re-upload data files after stopping the validation by clicking the [Stop validation] button. After revision, click the [Validate data files] button and start validation again.

FAQ: How to deal with validation errors?

Submission status is backed to “metadata_submitted”. Revise and re-submit metadata or re-upload data files.

Accession numbers

When both the metadata and sequence data are validated (Status “submission_validated”), accession numbers with the prefix DR (Submission (DRA)，Experiment (DRX)，Run (DRR)，Analysis (DRZ)) are assigned (“acc_issued”, “complete” or “private”). Accession numbers are displayed in the “Component”.

Limited-time access to archived fastq/SRA files

To allow submitter to download and check archived fastq/SRA files, the files are copied to the following directories on the ftp-private.ddbj.nig.ac.jp server. To save disk space, the copied files are automatically deleted in one month.

• (submitter’s home)/report/dra/(DRA submission accession)/fastq/
• (submitter’s home)/report/dra/(DRA submission accession)/sra/

例

• submitter/report/dra/DRA000001/fastq/DRR000001.fastq.bz2
• submitter/report/dra/DRA000001/fastq/DRR000002.fastq.bz2
• submitter/report/dra/DRA000001/fastq/DRR000002_1.fastq.bz2
• submitter/report/dra/DRA000001/fastq/DRR000002_2.fastq.bz2
• submitter/report/dra/DRA000001/sra/DRR000001.sra
• submitter/report/dra/DRA000001/sra/DRR000002.sra

Data release

After the registered data is loaded into the database, the Status becomes “complete (private)” and the submission is kept private until one of the following conditions are met.

• A. Submitter requests to release their data.
• B. Submitter has published their accession number(s) and it has been confirmed.
  We do not release the data when its accession number(s) has been published wrongly by other than the submitter.
  “publish” means to disclose accession number(s) to the public through paper, thesis, academic meeting, internet, press report etc.
• C. Specified hold-date has come.
• D. DDBJ/EMBL-Bank/GenBank records (e.g., TSA, WGS, CONetc.) citing DRA Run (DRR) accession number(s) have been made public.

Data are released without permission from submitters in the cases B, C and D. In the case D, an entire DRA submission contains cited DRR Run(s) is made public.

FAQ: How are linked BioProject/BioSample/sequence data released?

When the data is released, in a few days, the released data will become searchable at DRASearchand the data will be mirrored to the NCBI SRA.

The list of available fastq files at the DRA file server: fastqlist

FAQ: How to request data release?

Update submission

Update in each database

Change hold date

You can set the hold date for a maximum of 4 years and can change it. To change the hold date, click the [Change] button in the Hold Date and move to hold date change page.

To immediately release the submission, click the [Release Now]. In the middle of the night, the submission is released, data files will be made available at ftpand metadata will be indexed by the DRA search systemin a few days.

Update metadata

Update metadata by clicking the [Enter / Update metadata] button. A part of fields are blocked from editing. After editing your metadata, please be sure to click the [Submit/Update DRA metadata] button and reflect the updates to the DRA server.

Add data files

Data files cannot be directly added to the archived Run. In another DRA submission, create new Experiment-Run objects referencing existing BioProject and BioSample records to add data files.

Similar to Run, data files cannot be directly added to the archived Analysis. To replace archived Analysis, please contact to the DRA team.

Login D-wayand create a new submission by clicking the [New submission]. Select the BioProject and BioSample IDs to which data to be added. Next, add the DRA Experiment and Run objects.

• To add a new sample, share a BioProject ID and create a BioSample - Experiment - Run in a new DRA submission.
• To add data files to existing sample, share BioProject and BioSample IDs and create an Experiment - Run in a new DRA submission.

Submit metadata and validate the appended data files. Accession numbers will be issued to the appended Experiment/Run objects.

To add data files to the existing DRA submission, please contact us.

Withdraw archived objects

To withdrawing archived Experiment, Run and Analysis objects, please contact us.

Supplement: MD5

MD5 (Message Digest Algorithm 5) is a hash function which calculates a hash value (MD5 number, 32-digit numbers and letters) of a given file. Because the MD5 number of the damaged file is distinct from the original one, we can check whether the transferred file is intact or not by comparing the numbers before and after the file transfer.

$ md5sum file1 file2
9F6E6800CFAE7749EB6C486619254B9C file1
B636E0063E29709B6082F324C76D0911 file2

$ md5 file1 file2
9F6E6800CFAE7749EB6C486619254B9C file1
B636E0063E29709B6082F324C76D0911 file2