• (August 14 to 17) DDBJ Center Closing for Summer Break
  • Revision of the Terms of Use (Access and Benefit-Sharing)

DDBJ Annotated/Assembled Sequences

  • Home
  • Submission
    • Before Submission
    • Web submission
    • Mass Submission
    • Data Update
  • Search
    • getentry
    • ARSA
  • Flat file
    • Feature Table
    • Feature key
    • Qualifier key
    • Nucleotide Sequences
    • Organism qualifier
    • Identifiers
    • Description of Location
    • Protein Coding Sequence
    • The Genetic Codes
    • Codes Used in Sequence Description
    • Description Examples of Sequence Data
  • Data categories
    • Data Submission from Genome Project
    • Pseudohaplotype
    • WGS
    • Finished level genomic sequences
    • Metagenome Assembly
    • Single amplified genome
    • HTG
    • Environmental sample
    • ENV
    • TLS
    • Data Submission from Transcriptome Project
    • TSA
    • EST
    • HTC
    • Third Party Data (TPA)
  • FAQ
  • Other
    • Patent
    • MGA
  • Home
  • ddbj
  • MGA

MGA

[Caution] DDBJ terminated accepting new submission of MGA data.

In order to accept a large scale of sequence data that provide useful information for annotation of genome assemblies/sequences, the INSDC have created a new category.
The name of this new category is Mass sequence for Genome Annotation (MGA).
The definition of MGA data is the following.

The definition of MGA data
MGA is defined as those sequences which are produced in large quantity in view of genome annotation.
The data which can be acceptable to the MGA category of INSDC are
Those which include useful biological features for genome annotation ( e.g. start or end terminus of a transcript). The large of quantity here means that the number of sequences in one resource is 10,000 or more.

Sample flat file

MGA data are published a resource as a unit. The data consist of “Master record” and “Variable record” for a resource.

Master record

Common parts of information such as submitters, keywords (MGA and others), references, comments and so on. Master record is provided for every resource unit.

Example

LOCUS       ZZZZZ0000000                       mRNA    linear   ROD 24-JAN-2005
DEFINITION  Mus musculus 1 month adult cerebellum short transcripts tag.
ACCESSION   ZZZZZ0000000
VERSION     ZZZZZ0000000.1
KEYWORDS    MGA; CAGE (Cap Analysis Gene Expression).
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciurognathi; Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1450)
  AUTHORS   Mishima,H., Yamada,T. and Liu,G.Q.
  TITLE     Direct Submission
  JOURNAL   Submitted (30-NOV-2009) 
            Contact:Hanako Mishima
            National Institute of Genetics, DNA Data Bank of Japan; Yata 1111,
            Mishima, Shizuoka 411-8540, Japan
REFERENCE   2
  AUTHORS   Mishima,H., Shizuoka,T. and Fuji,I
  TITLE     The gene expression analysis of short transcripts tags
  JOURNAL   Unpublished (2010)
COMMENT     The CAGE (cap analysis gene expression) is based on preparation
            and sequencing of concatamers of DNA tags deriving from the
            initial 20/21 nucleotides from 5' end mRNAs.
            Full-length cDNAs were at first selected with the Cap-Trapper
            method. Then, a specific linker (Linker1, some linker contain 5 bp
            sequences that have 15 variations for each rna sample) containing
            the ClassIIs restriction enzyme site MmeI was then ligated to the
            single-strand cDNA and then the second strand of cDNA synthesized.
            (omitted)
FEATURES             Location/Qualifiers
     source          
                     /db_xref="taxon:10090"
                     /dev_stage="1 month adult"
                     /mol_type="mRNA"
                     /organism="Mus musculus"
                     /strain="C57BL/6J"
                     /tissue_type="cerebellum"
MGA         ZZZZZ0000001-ZZZZ0340780
            total number of count : 856609
            Header Format
            >[ACC#]|[submitter's identifier]|[number of sequence
            count]|[map]|[free text]|[db_xref1(,db_xref2,...)]|
//

Variable record

All nucleotide sequences of the resource unit described in the Master record, and the items specific to each sequence, such as map location, count number of the sequence, and db_xrefs.

Example

>ZZZZZ0000001|ABC1004AA60F1902|10|9B|lipidosis-related protein Lipidosin| 
GI:2385656|
gactgtcttcggtgaatgca
>ZZZZZ0000002|ABC1003AE78G1607|5||||
gcggaagtcggaccggtcgca
>ZZZZZ0000003|ABC1003AE72P1806|6||||
gggagaccgatccgggatct
>ZZZZZ0000004|ABC1003AE30G1801|91||||
gagtcgggtcggtggggctgt
>ZZZZZ0000005|ABC1003AA45J1501|55||||
ggggaatctgcagcctgggc
>ZZZZZ0000006|ABC1003AE67B0902|152||||
gagccgtccccgacgccgcca
 (Followings are omitted) 
Format: >[ACC#]|[submitter’s identifier]|[number of sequence count]|[map]|[free text]|[db_xref1(,db_xref2,…)]|
  • One entry is consisted of “Header” line and nucleotide sequence.Header line starts “>” and follows six items related to each entry.Six items are delimited by “|”(pipe).
  • The related information of an entry can be changed, but revise of nucleotide sequence can not be allowed. If the sequence which has already been submitted into INSDC is taken from identical resource, the item, [number of sequence count] of the entry has to be updated.
>ZZZZZ0000001|ABC1004AA60F1902|100|9B|lipidosis-related protein Lipidosin| MGI:2385656|
gactgtcttcggtgaatgca
ZZZZZ0000001 [ACC#] accession number of the entry
ABC1004AA60F1902 [submitter’s identifier] identifier assigned by submitter to the entry
100 [number of sequence count] number of the count of this entry in the resouce
9B [map] map information
lipidosis-related protein Lipidosin [free text] Map location (in this case, chromosome number)
MGI:2385656 [db_xref1(,db_xref2,…)] free-text-formatted description of the entry
gactgtcttcggtgaatgca external database information of the entry

Related pages

  • Data Submission from Genome Project
  • Submission of environmental sequences
  • Data Submission from Transcriptome Project
  • Third Party Data (TPA)